Apache2 Ubuntu Default Page . It works! This is the default welcome page used to test the correct operation of the Apache2 server after installation on Ubuntu systems. ... Ubuntu's Apache2 default configuration is different from the upstream default configuration, and split into several files optimized for interaction with Ubuntu tools. ... The configuration layout for an Apache2 web server installation on Ubuntu systems is as follows: /etc/apache2/ |-- apache2.conf | ... Document Roots . ...
Cell Biology International 27 (2003) 293294 Cell Biology International www.elsevier.com/locate/jnlabr/ycbir Short communication Microtubule dynamics in living cells : direct analysis in the internal cytoplasm Ivan A. Vorobjev a a,* , Irina B. Alieva a, Ilya S. Grigoriev b, Gary G. Borisy c Laboratory of Cell Motility, A.N. Belozersky Institute, Moscow State University, Moscow, Russia b Department of ... These data demonstrate that MT growth is impeded at the cell margin. ...
[
Текст
]
Ссылки http://cellmotility.genebee.msu.ru/html/articles/Vorobjev03.pdf -- 67.3 Кб -- 04.03.2004 Похожие документы
The Future of GPU Computing Wen-mei Hwu University of Illinois, Urbana-Champaign Agenda · · · · Setting the Context Current Victories Coming Battles Conclusion and Outlook NVIDIA HPC Day Moscow State University 2012 CPUs: Latency Oriented Design · Large caches Convert long latency memory accesses to short latency cache accesses ALU Control ALU ALU · Sophisticated control Branch prediction for reduced branch latency ... NVIDIA HPC Day Moscow State University 2012 ...
[
Текст
]
Ссылки http://ccoe.msu.ru/sites/default/files/presentations/Moscow-Keynote-Hwu-10-22-2012.pdf -- 1614.3 Кб -- 25.10.2012 Похожие документы
L omonosov Moscow State University (MSU) is the oldest University in Russia. ... Its head had become Professor Petr Ivanovich Strakhov (1757?1813) who played an important role for Physics progress at Moscow University. ... In May 1805, the University Board elected Prof. Strakhov Provost of Moscow State University. ... T o honor his contribution into science development Professor Lebedev was nominated to the Nobel Prize. ... In 1933 the Faculty of Physics was established in Moscow State University. ...
THE RUSSIAN STYLE OF CIVIL PROCEDURE Dmitry Maleshin Reprinted from Emory International Law Review Volume 21, No. ... 26 See id. ... Another exceptional feature of the Russian civil procedure is the original status of judicial precedent as a source of Russian civil procedural law. ... 98 See OSCAR G. CHASE, LAW , CULTURE, AND RITUAL: DISPUTING SYSTEMS IN CROSS-CULTURAL CONTEXT 53-55 (2005); JAMES ET AL., supra note 6, at 309-10; THOMAS MAIN, GLOBAL ISSUES IN CIVIL PROCEDURE 5 (2006); Oscar G. Chase. ...
... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...
[
Текст
]
Ссылки http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/poster_mccmb_2011.pdf -- 225.5 Кб -- 21.07.2011 Похожие документы
Please enter the lightcurve file name and period search parameters: . Lightcurve file: . ... Apply the Heliocentric correction and convert all dates to Terrestrial Time (TT)? ... Phase range for plots: -0.5 to 1.0 0.0 to 2.0 0.0 to 1.0 . ... Also, the Heliocentric correction cannot be applied to such lightcurves. ... Two period search methods are currently implemented. ... This period search service is also available at the mirror sites: Mirror 1 , Mirror 2 , Mirror 3 , Mirror 4 . ...
МГУ имени М.В.Ломоносова Русская версия . ... Science calendar . ... Art Criticism and History . ... Economics . ... Chairman : Professor, Doctor of Technical Science Kravets Victor A. ( Deputy director of science) . ... Chairman: Professor, Doctor of Economics, academician, Full member of the Russian Academy of Sciences Nekipelov Alexander D. ( Director of Moscow School of Economics department of Moscow State University) . ... World economy (Professor, Doctor of Economics Glinkina Svetlana P.) . ...
Заведующий кафедрой Head of the Chair . ... История кафедры . ... В 1966 г. для расширения ведущихся на кафедре научных работ в НИИ Ядерной физики МГУ был создан отдел физики плазмы (ОФП), в 1989 году переименованный в отдел микроэлектроники (ОМЭ). ... Сегодня по различным научным направлениям, ведущимся по специальностям, преподаваемым на кафедре атомной физики, физики плазмы и микроэлектроники, работает около 100 научных сотрудников, среди которых 12 докторов наук и около 50 кандидатов наук. ...
... Rod unfortunately was not able to come to Garmisch this year, but has been in touch with the Russian Internet community in Seoul, Sharm el Sheikh, Nairobi, and the United States, and has sent a special letter to Vladislav Petrovich. ... ICANN is working with regional associations and the Internet Society in a global training program that is raising the security awareness and skills of those DNS operators in regions where resources for such training are limited. ...
[
Текст
]
Ссылки http://www.iisi.msu.ru/UserFiles/File/bayern2010/sadowsky.doc -- 37.0 Кб -- 02.04.2012 Похожие документы
... Dear creators of the Bensons courses! First of all I would like to thank you for such a magnificent English course! ... Look, it's really much more interesting - to listen to a virtual book, to look through the pictures, let alone role-play! ... However, I'm very glad that I took up "Bensons" - the course has given me wonderful possibilities to learn more about English culture, to fill some gaps in my knowledge of English grammar and just to spend my time with great pleasure and benefit! ...
... On-line консультант . ... Приглашаем всех, интересующихся исследованиями и разработками в области компьютерных сетей, принять участие в семинаре по software-defined networking, который состоится 4 июля 2011 (понедельник) в 19.30 в Политехническом музее (Новая площадь, д 34;, подъезд 9, малая аудитория). ... We are about to witness a revolution in the networking towards so-called "Software Defined Networking" (SDN). SDN enables innovation in all kinds of networks . ... Copyright ВМиК МГУ , 2008 . ...
... Snecma Moteurs (Groupe Snecma, France) . ... The Colloquium-458, organized by EUROMECH , will take place at Institute of Mechanics of Lomonosov Moscow State University (MSU) . ... The subjects of the Colloquium-458 cover important problems dealing with the verification of constitutive equations, the organization of experiments, the connection between microstructures and mechanical properties and the effective utilization of the modern FEM packages. ... France. ... S.-Petersburg State Techn. ...
30 TH I NT E R N AT I ON AL C OSMIC R AY C O N F ER EN C E Search for global asymmetry of UHECR arrival directions with the TUS space detector P. K LI M OV 1 ,O. K AL ASHE V 2 , B . ... Introduction Space-based ultra-high-energy cosmic-ray detectors such as TUS or JEM/EUSO are best suited for searches of the global anisotropies in the distribution of arrival directions of cosmic-ray particles because they provide full-sky coverage with a single experiment. ... Phys. 12, 25 (1999). ... Phys. Lett. ...
[
Текст
]
Ссылки http://cosrad.sinp.msu.ru/experiments/tus/doc/global2007.pdf -- 136.8 Кб -- 19.03.2008 Похожие документы
... Basic statement: "Mathematics is much clever, than Mathematician" It means, that after the scientist or engineer developed new mathematical model and designed corresponding equations, the solution to these equations produces new information unpredictable for the author! ... This vibration excites the shear wave in tissue 2 sx 2 - (ct + ) s x = Fx 2 t t Studies in Fluid Dynamics of water jet are connected with two main problems: 1. Flows in contracting nozzle forming high-speed jet. ...
[
Текст
]
Ссылки http://acoustics.phys.msu.su/teachers/lecture/matmodel.pdf -- 421.8 Кб -- 18.10.2007
[
Текст
]
Ссылки http://acoustics.phys.msu.ru/teachers/lecture/matmodel.pdf -- 421.8 Кб -- 18.10.2007 Похожие документы
... Beklemishev M.K., Kuzmin N.M., Kardivarenko L.M. Extraction of silver complexes with aza-analogues of dibenzo-18-crown-6. ... Beklemishev M.K., Stoyan T.A., Dolmanova I.F.. ... Efremova T.A., Beklemishev M.K., Shumsky A.N., Dolmanova I.F. Determination of manganese by a catalytic method using oxidation of 3,3',5,5'-tetramethylbenzidine with potassium periodate. ... Kapanadze A.L., Beklemishev M.K., Dolmanova I.F. Determination of organophosphorus pesticides by a catalytic method on TLC plates. ...
... Course work . Practical work . ... Head of chair: . ... About chair . ... Coherent Optics Laboratory . Synchrotron Radiation Laboratory . Nanosystem physics laboratoryљљљљљљљљљљљљљљљљљљљљљљљљљљљљљљљљљљљљљљљљљљљљљљљљљљљљљљљљљљ . Fiber-optic communication laboratory . ... Chair history . ... Head of chair, professors and PhD biographies . ... October 19, 2014 . ...
... The optimal control, which led oscillatory system to a certain energy level from any initial conditions at minimum time, is found. ... A set of points where the trajectory becomes an arc of a circle with the other center is called the switching line. ... For drawing switching line near the origin (see for example Figure 3) we note from the system (1) that time is proportional to the sum of the angles 214 this sums for optimal and quasi-optimal processes. ... The control function (14) is not optimal....