... Гравицаппу можно изготовить из нескольких деталей по прилагающейся инструкции. ... Ввод: Вывод: Yes или No Пример: Ввод: 2 4 3 2 1 0 3 3 6 7 2 1 5 5 7 9 55677788899 5 88 7 234 Yes Вывод: Ввод: 4 4 2 0 4 6 4 2 446 66 4 466 No Вывод: Первый пришедший в голову алгоритм: взять список деталей для гравицаппы (последняя строка ввода) и выкидывать из него имеющиеся в наборе детали, а если некоторой детали в наборе нет, подставить в список вместо не? е? составляющие части. ... Решение. ... Отрезки. ...
[
Текст
]
Ссылки http://olympiad.cs.msu.su/wp-content/uploads/2012/04/solutions_2012_main.pdf -- 193.4 Кб -- 14.04.2012 Похожие документы
My name is Steve Foulkes, I have had the good luck to find SN 2000C in NGC2415. This is part of my discovery image which shows NGC2415 and the SN. ... Steve Foulkes . Image Data: . ... Object NGC 2415 recorded on 2000 Jan 8.789UT with a 0.26-m LX200 telescope on an image secured for the UK Nova/Supernova Patrol. ... The software is also used to analyse an image, and can to a limited degree, also indicate changes in the image. ... Back to Supernova 2000C in NGC 2415 . ...
... Ключевые слова: антропология, Отечественная война 1812 года, офицеры, дворяне, обобщенный портрет, Военная галерея Зимнего дворца . ... Для установления направления этнотерриториальных различий от-дельных признаков использовались нормированные разности Zi = (Mi - Mo)/S средних арифмети-чеѓских величин основных антропометрических признаков в разных сериях данных (Mi) от значе-ний московской выборки (Mo). ... Бурлак С.А. Время появления звучащей речи по данным антропологии (с. 110) . ...
Lomonosov Moscow State University . ... About Us . ... Further Education Programs . ... General Information . ... The Department of Linguistics and Information Technologies . ... The Department of Linguistics and Information Technologies was founded in 2008. ... The latest publication (?21, June 2012, 'Information Technology in Linguistics') was about the Fifth International Scientific and Methodological Conference 'ICT in Linguistics, Foreign Language Teaching and Intercultural Communication'. ...
... Будучи социальным психологом, он особенно интересуется экономической психологией, массовой коммуникацией и социальной теорией. ... Но даже и внутри нее экономическая психология - лишь нарождающаяся область. ... По их мнению, вплоть до недавнего времени прогресс экономической психологии основывался на попытках исследователей сохранять четкие границы между психологическими социологическим и экономическим подходами к потреблению. ... Лунт П. Психологические подходы к потреблению: вчера, сегодня, завтра...
... My field of specialization is Stability Theory, Nonlinear Dynamics, Asymptotic Methods, Mechanics of Solids, System Identification, Optimal Control, Economic Growth. ... A.O. Belyakov and A.P. Seyranian (2012). ... A.O. Belyakov and A.P. Seyranian, . ... A.P. Seyranian and A.O. Belyakov, Swing dynamics. ... A.O. Belyakov, A.P. Seyranian, and A. Luongo, Regular and chaotic dynamics of the swing. 6th EUROMECH Nonlinear Dynamics Conference (ENOC 2008) , Saint Petersburg, Russia, June, 30 - July, 4 2008...
... БИБЛИОТЕКА НИИЯФ МГУ . ... Полный список журналов ELSEVIER и SpringerLink доступных в 2011 году . ... Электронные ресурсы НИИЯФ МГУ . ... Acta Physica Hungarica, New Series, Heavy Ion Physics . ... Applied Physics Letters . ... аннотации . ... Astrophysical Journal, Astrophysical Journal Letters, Astrophysical Journal Supplement series . ... Journal of Physical Chemistry A . ... The European Physical Journal - Applied Physics . ... The European Physical Journal E: Soft Matter and Biological Physics ...
... Co-Chair , ICONO/LAT 2013 . Director, Institute of Laser Physics . ... Russia . ... Conference venue . Moscow, Russia . Program overview . Program topics . ... Advance program . ... Visa to entry Russia . ... ICONO/LAT conference is the leading event in the area of quantum electronics, laser physics, and their applications. ... You are greatly welcome to attend the ICONO/LAT 2013 conference in Moscow, Russia. ... International Laser Center, M.V.Lomonosov Moscow State University . ...
... Director of the Institute of World Culture . Member of Russian Academy of Sciences . ... Moscow State Lomonosov University (MGU); Institute of Slavic Studies of the Russian Academy of Sciences; Russian State Humanities University (RGGU); University of California, Los Angeles (UCLA), Department of Slavic Languages and Literatures and Indo-European Studies Program. ... Director of the Research Institute of World Culture of the Moscow Lomonosov State University (MGU), 1989-present. ...
... Разработка и внедрение образовательных программ повышения квалификации специалистов в области инновационной деятельности . ... Master Degree in Geology . Master Degree in Management . Master Degree in Chemistry . ... 06/04/2016 . ... 29 марта 2016 г. День открытых дверей Высшей школы инновационного бизнеса . ... 27 марта 2016 года Московский государственный университет имени М.В.Ломоносова приглашает на весенний ДЕНЬ ОТКРЫТЫХ ДВЕРЕЙ . ... New technologies in gas chemistry . ...
... 000, 112 (2009) Printed 11 February 2010 A (MN L TEX style file v2.2) Analytical approximations of K -corrections in optical and near-infrared bands I1gor V. Chilingarian1 2 ,2,3 , Anne-Laure Melchior 1,4 and Ivan Yu. ... Received 2010 February 01; in original form 2009 August 14 ABSTRACT To compare photometric properties of galaxies at different redshifts, the fluxes need to be corrected for the changes of effective rest-frame wavelengths of filter bandpasses, called K -corrections. ... Table 1. ...
... Краткий отчет: По данным эксперимента CMS в протон-протонных столкновениях при энергии 7 и 8 ТэВ. измерены сечения одиночного рождения топ кварка в t-канальной моде и в ассоциации с W бозоном. ... Продолжено изучение электрон-протонных взаимодействий на данных полученных ep-коллайдером HERA в эксперименте ZEUS. ... Рисунок 1.1. ... B718 (2013) 1229-1251] и [CMS-PAS- B2G-12-010]. ... На левом рисунке представлены результаты измерения сечений рождения бозона Хиггса в разных каналах распада. ...
[
Текст
]
Ссылки http://www-hep.sinp.msu.ru/hep/open_docs/LEHEP_otchet_2013.doc -- 1696.0 Кб -- 17.12.2013 Похожие документы
... Подготовительные курсы физического факультета . ... Курсы для школьников / Курсы от школ-партнеров / ГБОУ Гимназия ?1272 Курсы для школьников / Курсы от школ-партнеров / ГБОУ Гимназия ?1516 Курсы для школьников / Курсы от школ-партнеров / ГБОУ СОШ ?1159 Курсы для школьников / Курсы от школ-партнеров / ГБОУ Школа ?2065 Курсы для школьников / Курсы от ... курсы проводятся преподавателями физических и математических дисциплин физического факультета. ...
Welcome to the site of the Laboratory of Mathematical Models of Quantum Scattering Processes . ... It develops mathematical models of ionizing collisions in atomic, molecular, and condensed matter physics. Main areas of current research activity include single and multiple ionization by electron, ion, and photon impact, ionization processes in strong laser pulses, and laser-assisted ionizing collisions. ... Research | ... c) Laboratory of mathematical models of quantum scattering processes, 2012 . ...
... Сообщения без ответов | ... Список форумов . ... Форум . ... Сообщения . Последнее сообщение . ... Модератор: PARALLEL.RU . ... Serg_Zhum . ... Официальный форум для поддержки пользователей системы X-Com . ... Нет сообщений Удалить cookies конференции | ... Зарегистрированные пользователи: нет зарегистрированных пользователей . ... Всего сообщений: 5507 | ... Непрочитанные сообщения . Нет непрочитанных сообщений . Форум закрыт . Создано на основе phpBB Forum Software phpBB Group . ...
... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...
[
Текст
]
Ссылки http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/poster_mccmb_2011.pdf -- 225.5 Кб -- 21.07.2011 Похожие документы
... Laboratory of Problems for Magnetism, . ... Study of the magnetic and transport properties of R-3d intermetallic compounds with a magnetic instability of the itinerant-electron subsystem. ... const at high temperatures (Curie-Weiss law) [A.S. Markosyan, Y. Hosokoshi, K. Inoue, Phys. Lett. ... Gaidukova, Y. Hosokoshi, K. Inoue, A.S. Markosyan , Magnetic phase diagram and pressure effect on the magnetic properties of the Y 1? x Gd x Mn 2 intermetallic compounds, J. Phys.: Condens. ...
... The Semantic Dictionary RUSLAN-1, the last version being Russian-to-English direction, is a tool for semantic and informational analysis of any coherent Russian text. The rich semantic information contained in the dictionary makes possible local, within one phrase, semantic interpretation as well as semantic analysis of coherent texts. ... Text understanding is very closely related to information analysis (Leontyeva 2000). ... We therefore call it "relative understanding". ...
Рейтинг страниц в теме: . Любительская астрономия - проекты и персональные страницы . ... NEW! - страница внесена не более 15 дней назад, . New! - страница внесена 16-30 дней назад, . ... new! - страница внесена 61-100 дней назад. б) В графе "Голоса" по категориям указаны только последние голосования (стек из 20 голосов) - средняя оценка расчитывается именно на их основе. ... Оценено и сдано в архив! . ... Александр В. Халевин . ... НАЗАД, В СПИСОК КАТЕГОРИЙ (титульная страница AstroTop-100) . ...