. КОМПЬЮТЕРЫ . Решение астрономической задачи N тел на кластере из ГПУ (pdf) . Exploring weak scalability for FEM calculations on a GPU-enhanced cluster (pdf) . Using GPUs to Improve Multigrid Solver Performance on a Cluster (pdf) . ClawHMMER: A Streaming HMMer-Search Implementation (pdf) . Проект Folding@Home . Лаборатория Параллельных информационных технологий НИВЦ МГУ .
. # . Home . Services . Interaction . Calculate Hydrogen bond, Water bridges and Hydrophobic interaction for . Home Browse Download Help About Us . List of complexes . Pfam families . SCOP families . Interaction classes . Interaction modes . GO terms . ERROR! File was not found. NPIDB team 2003 - 2016 . text .
... There is a serious question in Congress' agenda - strategy of Higher School development, and certainly, vital problems of your institutions, especially actual in the current economic situation. ... A month ago, I have given several commissions, aimed to support Russian students, the system of higher professional education and job placement of graduates. ... I would like to mention that legal requirements to establish Federal and national research universities are formulated now. ...
... Carbon and Nitrogen As Resources Limiting the Growth of Mono- and Mixed Cultures of Pseudomonas aeruginosa Dissociants P. V. Fursovaa, E. S. Mil'kob, and A. P. Levichc c Department of Biophysics Department of Microbiology Department of General Ecology, Moscow State University, Moscow, 119991 Russia e-mail: fursova @biophys.msu.ru b a Received December 26, 2006 Abstract--New experiments for detection of resources limiting the ... 1997; Levich, 2000). ... 1) (Levich et al., ...
... The experimental data obtained using Cherenkov light of EAS reflected from the snow surface of the Big Alma-Ata Lake (Kazakhstan) are presented. ... The balloon-borne measurements in the energy range 10 15 -10 20 eV are planned. ... SPHERE detector array was elaborated for balloon-borne experiment [3-5]. ... SPHERE detector was situated on the 160 m high mountain ledge nearby the B.Alma-Ata lake (2500 m above sea level) to detect Cherenkov light reflected from the snow surface of the lake. ...
... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...
[
Текст
]
Ссылки http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/poster_mccmb_2011.pdf -- 225.5 Кб -- 21.07.2011 Похожие документы
Tools for monitoring of data exchange in real-time avionics systems V.V. Balashov, V.A. Balakhanov, A.G. Bakhmurov, M.V. Chistolinov, P.E. Shestov, R.L. Smeliansky, N.V. Youshchenko Lomonosov Moscow State University, Dept. of Computational Mathematics and Cybernetics, Laboratory of Computer Systems e-mail: {hbd,baldis,bahmurov,mike,osmin,smel,yoush}@lvk.cs.msu.su Abstract In this paper we present a toolset for monitoring of data exchange through onboard channels of real-time avionics (RTA) systems. ...
[
Текст
]
Ссылки http://lvk.cs.msu.su/~bahmurov/course_realtime/papers/balashov_et_al_eucass2011_monitoring.doc -- 194.5 Кб -- 27.05.2015 Похожие документы
DNS Security, Stability and Resiliency John Crain Chief Technical Officer April 21st 2009 Garmisch 1 Monday, 20 April 2009 Agenda · The Global DNS SSR Symposium · Problems and Opportunities · Questions? ... The level of awareness with respect to the DNS is very low" All quotes from Symposium Report 7 Monday, 20 April 2009 Problems & Opportunities 8 Monday, 20 April 2009 Problem: · There is a need for training across all sectors of the industry to raise both skills and awareness. ...
[
Текст
]
Ссылки http://www.iisi.msu.ru/UserFiles/File/bayern2009/crain_pres.pdf -- 705.0 Кб -- 02.04.2012
[
Текст
]
Ссылки http://www.ipib.msu.ru/UserFiles/File/bayern2009/crain_pres.pdf -- 705.0 Кб -- 02.04.2012
[
Текст
]
Ссылки http://iisi.msu.ru/UserFiles/File/bayern2009/crain_pres.pdf -- 705.0 Кб -- 02.04.2012 Похожие документы
NMW survey overview . Access image archive . ... The New Milky Way survey aims to detect bright (V<13.5) optical transients near the Galactic plane using an automated wide-field (8x6 deg.) system capable of surveying the whole Milky Way area visible from the observing site in one night. ... All images obtained during the transient search survey are available online (please use the image archive access form ). ... Images per field: . ... Images per night: . ... Milky Way imaging time: . ...
ABSOLUTE PROPER MOTIONS OF 331 OPEN CLUSTERS . ... The proper motions of stars in the fields of 331 open clusters were taken from Four-Million Star Catalog (4M-catalog) of positions and proper motions (Volchkov et al. ... The absolute proper motions for 21 young open clusters have been derived by comparison of precise relative proper motions of individual stars and their corresponding absolute proper motions. ... Sign of proper motions in RA . ... 0.0001 arcsec/yr . ... rms error in RA proper motion . ...
... Публикации 2015 года . ... 2563496, 25 августа 2015 г. Тезисы докладов: . ... Москва: ЦИАМ им. П. И. Баранова, 2015. ... Волны в вязкоупругом слое, расположенном под слоем движущейся жидкости // Тезисы докладов VIII международной конференции 'Лаврентьевские чтения по математике, механике и физике'. ... Публикации 2014 года . ... Секция механики. 14 - 23 апреля 2014, Москва, МГУ имени М. В. Ломоносова. ... Публикации 2013 года . ... Секция механики. 15-23 апреля 2013, Москва, МГУ имени М.В.Ломоносова...
European Research Council ERC Grant Schemes Guide for Applicants for the Starting Grant 2012 Call Version 14/07/2011 The Guide is published by the ERC Scientific Council on http://erc.europa.eu It can also be downloaded from the Research & Innovation Participant Portal on http://ec.europa.eu/research/participants/portal/ and CORDIS page on http://cordis.europa.eu EUROPEAN COMMISSION FP7 Specific Programme IDEAS 1 IMPORTANT NOTICE Following the experience with previous calls, some adjustments and
... Laboratory of Medicinal Chemistry was established at the Department of Chemistry, Lomonosov Moscow State University in October 2013. ... We apply modern molecular modeling and chemoinformatics methods as well as develop new approaches. ... We have developed efficient methods for the analysis of quantitative structure-activity relationships and design of novel promising structures based on diverse theoretical approaches. ... Home . ... Research . ... 2016 Laboratory of Medicinal Chemistry ...
... Projects . ... 32-bit Microcontroller Programming . ... The project is working on creating a robot-platform which performs hopping movement, an absolutely new principle of movement for automatons. ... A robot requires a wide range of sensors and complex algorithms of position stabilization in order to keep calculations on stable position of the legs when walking on uneven surface. ... His field is the system of hop initiation while Serguey Lonchakov is working on the stabilization of the position. ...
... Advanced chapters of operation research . Algebraic characterization of basic solution of linear program. ... Advanced chapters of Actuarial Mathematics . ... Discounted cash flow analysis and capital budgeting as decision tools are given particular emphasis. ... In the first part of the course we present a modern approach to modeling economic systems. ... The problem of tax optimization under a given financing budget. ... Магистратура: master@cmc.msu.ru, 3-й этаж, комната 360, тел. ...
... September 20, 2004 Internet exchange operator Terremark Worldwide Inc. The total contract value is approximately $5.4 million, including all options and extensions. The contract terms include a two year contract for 600 square feet of colocation space and power, plus four one year extensions and options for two additional allotments of 600 square feet of space and power. ... longchamp outlet . ...
... Home . ... About the project . ... Financing . Main grant . ... Scientific results . ... In late 2014 the Moscow State University signed an agreement # 14-50-00029 with the Russian Science Foundation to perform scientific works on the theme "Scientific basis for the creation of the National depositary bank of living systems". Financing: total 750 million rubles, including: 300 million rubles in 2015 and 150 million rubles per 2016-2018 years. ...
... Воронин И.А., Барский Ф.И. Проблемы применения дифференциально-психологической методологии в исследовании личности // Ананьевские чтения-2009: Современная психология: методология, парадигмы, теория - Материалы научной конференции 'Ананьевские чтения - 2009', Вып. ... Барский Ф.И., Улановский А.М. Третья Международная конференция "Диалогическое я" // Вопросы психологии, 2004, N 6, с. 129-131. ... Моросанова В.И., Барский Ф.И. XI конференция ISSID // Вопросы психологии, 2003, N 5, с. 147-150. ...