... The optimal control, which led oscillatory system to a certain energy level from any initial conditions at minimum time, is found. ... A set of points where the trajectory becomes an arc of a circle with the other center is called the switching line. ... For drawing switching line near the origin (see for example Figure 3) we note from the system (1) that time is proportional to the sum of the angles 214 this sums for optimal and quasi-optimal processes. ... The control function (14) is not optimal....
... I.A. Kurova . ... The research is mainly devoted to the problems of generation, recombination and trapping of nonequilibrium carriers in amorphous hydrogenated semiconductors (a-Si:H, a-Ge:H, a-SiGe:H) and generation and relaxation of metastable states in these materials. ... Light-induced metastable states in undoped, doped and compensated a-Si:H films were studied in a wide temperature range. ... Effect of annealing on the photoelectric properties of boron-doped a-Si:H films. ...
... About the Institute . ... The International Summer School "Computer Technologies of Engineering Mechanical Problems" is a program designed for University students studying different branches of mechanics and engineering. ... The Summer School is organized in the Institute of Mechanics of Lomonosov MSU. ... The tradition of the Summer School arose from the cooperation between the Institute of Mechanics of Lomonosov MSU and Chien Hsin University of Science and Technology, Taiwan ( www.uch.edu.tw ). ...
... Journals . Memoirs of the Faculty of Physics . Moscow University Physics Bulletin . ... The conference papers from the School-Seminar ?Waves-2014? will be submitted for publishing in the Memoirs of the Faculty of Physics journal. ... Moscow University Physics Bulletin was founded in 1946 by Lomonosov Moscow State University and the Faculty of Physics. ... World-known physicists working at the Faculty of Physics (including 8 Nobel laureates) used to be and are the authors of the journal. ...
... 5-я летняя школа по геометрическим методам математической физики, 23-26 июня 2015 г. new . ... Лаборатория "Геометрические методы математической физики" была создана в декабре 2010г. после объявления победителей гранта Правительства Российской Федерации для государственной поддержки научных исследований, проводимых под руководством ведущих ученых в российских образовательных учреждениях высшего профессионального образования. ... на семинаре "Геометрия и группы" состоится доклад: . ...
... справочник учебные материалы ссылки программы . ... I Write the 2nd and 3d forms of the following verbs: . to make, to see, to find, to deal, to know . ... III Write synonyms of the following words. 1. importance, . ... IV Write Russian equivalents of the following. 1. a course of development, . ... Все интересные доклады были уже сделаны. новости студенты преподаватели лаборатории интернет-олимпиада по химии . справочник учебные материалы ссылки программы дни химика . ...
... About hotel . Services . ... The hotel ?69th Parallel? is glad to present its renewed website which now has an option of online booking! Feel free to share your opinion about us .. Hotel "69 Parallel" offers its guests meeting room for meetings, seminars and presentations. ... The cost of the lease without the use of equipment is 200 rubles for one hour. ... Order: (8152) 253-700, reserv@69parallel.ru . ... The hotel "69 Parallel" gives you the following list of services: . ...
... В игре принимают участие 2 команды по 5 человек в каждой. ... Игра состоит из 2-х периодов по 15 раундов каждый. ... Double Elimination Bo1: Double Elimination Winners (8 команд): de_train - первый раунд Double Elimination Winners (4 команды ): de_nuke - второй раунд Double Elimination Winners (2 команды ): de_dust2 - финал виннеров Double Elimination Grand Final (2 команды ): de_nuke, в случае победы лузеров играется решающий de_train Double Elimination Losers (4 ...
... Rod unfortunately was not able to come to Garmisch this year, but has been in touch with the Russian Internet community in Seoul, Sharm el Sheikh, Nairobi, and the United States, and has sent a special letter to Vladislav Petrovich. ... ICANN is working with regional associations and the Internet Society in a global training program that is raising the security awareness and skills of those DNS operators in regions where resources for such training are limited. ...
[
Текст
]
Ссылки http://www.iisi.msu.ru/UserFiles/File/bayern2010/sadowsky.doc -- 37.0 Кб -- 02.04.2012 Похожие документы
... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...
[
Текст
]
Ссылки http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/poster_mccmb_2011.pdf -- 225.5 Кб -- 21.07.2011 Похожие документы
... 2, JUNE 2007 1185 Commissioning of the CMS Magnet Domenico Campi, Benoit CurИ, Andrea Gaddi, Hubert Gerwig, Alain HervИ, Vyacheslav Klyukhin, Gilles Maire, Goran Perinic, Philippe BrИdy, Philippe Fazilleau, Francois Kircher, Bruno LevИsy, Pasquale Fabbricatore, Stefania Farinon, and Michela Greco Abstract--CMS (Compact Muon Solenoid) is one of the large experiments for the LHC at CERN. ... The construction of the CMS Magnet, and of the coil in particular, has been completed last year. ...
[
Текст
]
Ссылки http://lav01.sinp.msu.ru/nir/papers/IEEE_ASC_17_2_2007_1185_1190.pdf -- 496.1 Кб -- 08.04.2008 Похожие документы
... about ERC . education . research . ... The Lomonosov Moscow State University (MSU) has been training specialists in nanotechnology, nanomaterials and nanosystems for nearly ten years . ... MSU Nanotechnology Education and Research Center (ERC) was established to consolidate efforts of MSU units aimed at research and development and true cross-disciplinary education in nanotechnology, nanomaterials and nanosystems. ... Fundamentals of Nanotechnology? was the first step in ERC?s activity. ...
... PHYSICAL INSTRUMENTS FOR ECOLOGY, MEDICINE, AND BIOLOGY LaserElectron X-Ray Source for Medical Applications E. G. Bessonov, A. V. Vinogradov, and A. G. Tourianskii Lebedev Physical Institute, Russian Academy of Sciences, Leninskii pr. ... It includes two electron storage rings (E 50 MeV) placed in the vertical plane and two laser resonators located in the horizontal and vertical planes. ... Electrons can be injected into the storage rings singly or during several cycles through the injectors. ...
... M.V.Lomonosov Moscow State University Department of Physics, . ... 5-th All-Russian Conference . Nitrides of gallium, indium and aluminum: structures and devices " . ... Four All-Russian Conferences "Nitrides of Gallium, Indium and Aluminum: structures and devices" took place in Russia during 2001-2005 (in Moscow and St.-Petersburg). The conferences enjoyed the support from RFBR and the Ministry of Industry and Science. ... Nitrides of Gallium, Indium and Aluminum: structures and devices". ...
This domain may be for sale - этот домен возможно продается . ... The gathered information about your visits to this and other websites are used by these third party companies in order to provide advertisements about goods and services of interest to you. ... If you would like more information about this practice and to know your choices about not having this information used by these companies, click here . ...
... THE TIME HAS COME FOR "THUNDER BOOKS" . ... You may have forgotten what a thunder book is, or maybe you didn't ever use that name. ... It is a handy reference to those things you need to know about soils and how they behave. ... Well, if you knew how to use them as pages in a thunder book it would surely be a good start, but you need something uniquely yours. ... It has always been my belief that the mission of a soil survey is to help people understand and wisely use soil resources. ... Good read. ...
... The 2016 Beacon Satellite Symposium will be held at the International Centre for Theoretical Physics (ICTP) at Trieste, Italy, from 27 June to 1 July 2016. ... Абстракты - 15/02/2016 . Подробнее на сайте: http://t-ict4d.ictp.it/beacon2016 . Конференция "Распространение радиоволн" имеет более чем 40-летнюю историю и проводится раз в два-три года в центральных городах России. 15 декабря 2015 г. - начало регистрации участников и представления текстов докладов . ... D.Физика атмосферы . ...
SUNY-MSU Partnership . ... MSU | ... The State University of New York/Moscow State University partnership dates back to the mid-1970s and owes its existence to the vision of then MSU Rektor Rem Kokhlov and SUNY Chancellor Ernest L. Boyer. ... The first students were exchanged in 1977. ... A SUNY Center on Russia and the United States opened its doors in January 2000, and a sister MSU Center on the United States and Russia was set up in Moscow at MSU?s newly built Science Park. ... suny-msu . ...
... The detectors used in the setup had efficiency three orders of magnitude better than ones used before. ... As a result, effect of nonlocal influences of several largescale processes related with the weather changes, the geomagnetic variations, the ionospheric and solar activity have reliable been detected. ... йи з ед гв б 7 (2) (3) (4) All known local factors influencing on : temperature, pressure, chemism, illumination, electric field etc. must be excluded or stabilised. ...
[
Текст
]
Ссылки http://temporology.bio.msu.ru/EREPORTS/korotaev_experimental.pdf -- 224.4 Кб -- 27.02.2014 Похожие документы