... www.net.cmu.edu (Carnegie Mellon University, Pittsburgh, PA - English) - D . ... Washington, DC - English) - A* This site is a general network-troubleshooting utility; it runs BGP, ping, traceroute, and a number of other routing-related utilities. ... www.efrei.fr (Efrei's, Paris - French) - * Options for timeout, TTL, name resolution . ... English) . ... Each one has a link to a network information tool, which will do an nslookup, visual ping, 30-packet ping, or traceroute to it. ...
... Помогите написать диплом, пожалуйста!!!! (9235 просмотра) . ... magdalina . Написано: 2009-01-08 12:52 . ... Может менять полностью область исследования и тему диплома? Подскажите, пожалуйста!! ... Vol 76(6), Dec 2008, 1015-1021.AbstractFew studies have examined predictors of weight regain after significant weight losses. ... Planning to lose weight: Randomized controlled trial of an implementation intention prompt to enhance weight reduction among overweight and obese women. ...
... Recreational Geography and International Tourism . ... Physical Geography and Landscape Science . ... Science . ... According to the fact that ecological conflicts has a global scale in international watersheds, transboundary location of Selenga river complicates the problem of scientific resolution of the conflicts between water consumers. ... International programme in Natural Resource Management and Law offers a unique combination of Natural and Environmental Sciences and Science of Law. ...
Strict Standards : Non-static method JLoader::import() should not be called statically in /wcmc/ms/ms/libraries/joomla/import.php on line 29 . Strict Standards : Non-static method JLoader::register() should not be called statically in /wcmc/ms/ms/libraries/loader.php on line 71 . ... Deprecated : Non-static method JFactory::getConfig() should not be called statically, assuming $this from incompatible context in /wcmc/ms/ms/libraries/joomla/application/application.php on line 726 . ...
... Multi-threaded search engines . ... Unfortunately, most documents on search engines I saw in the Internet were either lists of hyperlinks without any comments, or discussions about how many documents are in the database of ... (here is the name of a search engine) and what method of counting of the number of documents was used. No words about the efficiency, i.e. how many documents on some subject I can find using this search engine, especially in comparison with the other ones. ...
... Structure of Data . ... Catalog . ... In SAI OCL Catalog, we introduce our work on investigation of the Milky Way system of open star clusters. The main goal of our study is a search for new clusters using huge surveys. 168 new clusters have been already discovered by us using J,H,Ks data from 2MASS point source catalog. ... For 141 new clusters, we found their physical parameters using J,H,Ks data from 2MASS catalog and, for a number of clusters, our UBVRI CCD observational magnitudes. ...
... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...
[
Текст
]
Ссылки http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/poster_mccmb_2011.pdf -- 225.5 Кб -- 21.07.2011 Похожие документы
... Hot though was the night air . Hot though the night air was . Hot as the night air was . Hot although the night air was . ... Harvard University has . At Harvard University . Harvard University, with its . There at Harvard University . ... 21 ... single dialect of American English has ever become dominant. ... they do arrive . they did arrive . did they arrive . have they arrived . ... fell ... have raised . fell ... raised . fell ... have risen . ...
... An extended set of observables of the nuclear quasi-free (p, d + ) reaction including the triple differential cross-section for coincidence measurements, its analyzing power in case of polarized proton beams and, also, the parameters of the polarization of the excited recoil nucleus and the produced deuteron are considered in the framework of the distorted-wave impulse approximation using the reaction 16 O(p, d + )15 N at a proton energy of 650 MeV as an example. ...
[
Текст
]
Ссылки http://np-chair.sinp.msu.ru/download/epja100510-offprints.pdf -- 426.2 Кб -- 18.03.2015 Похожие документы
... Настройка OpenVPN для ОС семейства Windows описана на веб-сайте службы технической поддержки факультета ВМК . В данном разделе описывается подключение к VPN факультета в ОС GNU/Linux с помощью графического интерфейса, предоставляемого программой KNetworkManager на примере ОС openSUSE 11.2 x86-64. Кликните левой кнопкой мыши по иконке программы KNetworkManager в системном трее и выберете пункт Manage connections : . ... Также нужно выставить галочки ?Use LZO compression? и ?Use TCP connection?: ...
... Настройка OpenVPN для ОС семейства Windows описана на веб-сайте службы технической поддержки факультета ВМК . В данном разделе описывается подключение к VPN факультета в ОС GNU/Linux с помощью графического интерфейса, предоставляемого программой KNetworkManager на примере ОС openSUSE 11.2 x86-64. Кликните левой кнопкой мыши по иконке программы KNetworkManager в системном трее и выберете пункт Manage connections : . ... Также нужно выставить галочки ?Use LZO compression? и ?Use TCP connection?: ...
... Alexander A. Moskovsky . ... Software Designer : . ... Projects: . Janitor II, Custodian III for Matrix Logic - utilities for DOCS Open EDMS (electronic document management system), C++/Win32 platform. ~2 man-year project with 5 persons team. iBuzz - (for ibuzz.com ) large client-server system (Win32, Enterprize Java Beans, Oracle, Sun/Solaris). ... Lunch Ordering Web System. ... Software Resources International , former Digital Moscow Software Center, . ... Physical Chemistry chair, . ...
... Выберите Моя библиотека Библиотека 5.х Эйдос Протокол Z39.50 Библиотека 4.02 -> 5.x Библиотека 4.02 Куб Общие вопросы Сигла Эйдос 4.0 ТрансЭйдос . ... Система. ... Не работает русский язык в Библиотеке 4.02. ... Компания 'Библиотечная компьютерная сеть' разрабатывает и внедряет Автоматизированные библиотечные информационные системы ( АБИС ): каталогизатор книг - создание электронного каталога библиотеки , учет книг . ...
The Early Music Theatre >> Repertoire >> The Prophetess.. The Prophetess (The History of Dioclesian) is a masterpiece of the English Restoration opera. ... There is little good to say about most late Roman emperors. ... Muscovites know very well a Roman officer who suffered because of his religious beliefs under Dioclesian: the future martyr Saint George the Winner.) ... You shouldn't joke", the prophetess responded, "because you will become an emperor, Dioclus, when you kill Aprus". ...
. Fatal error : Can't use method return value in write context in /webs/cacs/system/application/modules/changepass/controllers/changepass.php on line 17 .
... defmacro defprinter ( name args &body body ) . ... body ) ) . ... defprinter :property ( type name &rest body ) . print-statement-with-body stream body nil "public ~a ~a" type name ) ) . ... defprinter :get ( &rest body ) . print-statement-with-body stream body nil "get" ) ) . ... defprinter :constructor ( name args &rest body ) . ... defprinter :class ( name &rest body ) . print-statement-with-body stream body t "public class ~a" name ) ) . ... defprinter :namespace ( name &rest body ) . ...
Образовательные стандарты МГУ . ... Тексты стандартов . ... Нормативные документы . Внедрение стандартов . ... 010400 Прикладная математика и информатика . Автор: Anonymous . ... Автор: zemtsov . ... Об изменении образовательных стандартов МГУ . ... О внесении изменений в самостоятельно устанавливаемые образовательные стандарты высшего профессионального образования МГУ . ... Об утверждении и изменении образовательных стандартов МГУ . ... Об утверждении образовательных стандартов МГУ . ...
... Superoxide dismutase (SOD, EC 1.15.1.1) and catalase (CAT, EC 1.11.1.6) together with low-molecular mass antioxidants act as the main defense against ROS produced in various parts of plant cells. ... For investigation of enzyme (SOD, CAT and PAL) activity were used 17 day leaves of controlled and treatment plants. ... ilshat.rafkatovitch@gmail.com - in vitro , 302 . ... H2O2 , H2O2 , H2O2 . ... H2O2- , , . ... 307 Tribulus terrestris L. , .., , , handy_89@mail.ru in vitro . ... PepP Synechocystis sp...
[
Текст
]
Ссылки http://plantphys.bio.msu.ru/conferences/thesis/2014_plantphys.pdf -- 889.8 Кб -- 24.04.2014 Похожие документы