... The Sixth International Conference «Scientific Issues in Security and Combating Terrorism », Moscow, 11 - 12th of November, 2010 The Council of Europe approach to the international information security in the context of the fight against terrorism Ms. Marta Requena, Head of the Public International Law and Anti- Terrorism Division Head of the Counter Terrorism Task Force, Council of ... States certainly remain the principle actors of the fight against terrorism. ...

Еще в разделе: (Показать все результаты (>9) - www.iisi.msu.ru/ )

• Институт Проблем Информационной Безопасности

Tomkovich & Soloviev: Schedule and geographic distribution on the breeding grounds 19 Curlew Sandpipers Calidris ferruginea on their breeding grounds: schedule and geographic distribution in the light of their breeding system P.S. TOMKOVICH1 & M.Y. SOLOVIEV2 1 Zoological Museum, Moscow Lomonosov State Univ., ... 1994, Schekkerman & van Roomen 1995), or the large fluctuations in species numbers on some breeding grounds (e.g. Tomkovich et al. ... Notes on the breeding habits of the Curlew Sandpiper. ...

Еще в разделе: (Показать все результаты (>39) - vertebrata.bio.msu.ru/ )

• Department of Vertebrate Zoology
• Courses
• Sergei V. Ogurtsov

((tr|Q9HWZ3:27.13469,(((((tr|Q97JG6:73.32871,sp|P52281:58.21097):22.08826, . (tr|Q8Y6Z1:50.97049,(tr|Q9KDW9:31.89890,(tr|Q99UH4:56.31642, . sp|P18156:43.43318):19.58605):11.29379):3.59077):71.07033, . (sp|Q51389:17.43830,((tr|Q8ZJK5:16.37272,sp|P11244:16.30590):17.93318, . sp|P44826:37.32225):18.11240):90.64721):85.73800, . tr|Q97P66:72.12900):67.97217,tr|P73809:39.02698):25.46760):7.46192, . ((tr|Q92ZW9:33.27410,tr|Q8UJW4:14.11857):8.47005, . sp|Q9L772:29.68911):15.56444,sp|P48838:30.29193); .

Еще в разделе: (Показать все результаты (>6) - bioinf.fbb.msu.ru/ )

• Bioinformatics Group of FBB MSU
• User's guide

План лекций по физике . ... Кинематика движущейся точки.Описание движения в координатной и векторной формах. ... Классический закон сложения скоростей . ... Инерциальные и неинердиальные системы отсчета. ... Понятия силы, массы. ... Центр масс системы материальных точек и закон его движения. Закон сохранения импульса. ... Кинетическая энергия точки, системы материальных точек. Потенциальные силы и потенциальная энергия; Закон сохранения энергии в механике, Обобщенный закон сохранения энергии. ...

Еще в разделе: (Показать все результаты (>13) - ferro.phys.msu.ru/ )

• Department of General Physics and magneto-ordered matter. Physics Department of

Лина - окончила с отличием Московский Государственный Университет Экономики, Статистики и Информатики. Работает заместителем начальника кредитного управления московского банка. Ольга - окончила с отличием Московский Государственный Университет Экономики, Статистики и Информатики. Работает начальником управления лизинговых операций московского банка. Александр - окончил с отличием Московскую Государственную Юридическую Академию. ...

Еще в разделе: (Показать все результаты (>2) - upmsu.phys.msu.ru/ )

... Point-split stress tensor and the Green's function. ... Casimir effect for a massless scalar field between two plates with the Dirichlet boundary conditions: one-particle states between the plates, explicit energy regularization and renormalization using the smooth cutoff. ... Casimir tension of a massless scalar field between two plates with the Dirichlet boundary conditions using the Green's function technique (the `pressure' Tnn version). ... Casimir energy renormalization. ...

Еще в разделе: (Показать все результаты (>4) - theorphys.phys.msu.ru/ )

... The enhancement is due to the resonant enhancement of the fundamental field in the cavity mode and the fulfillment of the phase matching condition at the photonic band gap edges of the photonic crystal and in the vicinity of the microcavity mode. ... The resonant THG enhancement was found in angular TH intensity spectra in the vicinity of the cavity mode and at the edges of the photonic band gap. ... Dashed lines indicate the angular shift of the THG resonance from the position of the cavity mode. ...

Еще в разделе: (Показать все результаты (>30) - shg.phys.msu.ru/ )

• http://shg.phys.msu.ru/ruscon/articles/pdf/03_JMMM_258_96.pdf
• http://shg.phys.msu.ru/ruscon/articles/pdf/97_josa_14.pdf
• http://shg.phys.msu.ru/ruscon/articles/pdf/04_PRB70_12407.pdf

About BAFIZ . BAFIZ at SINP MSU . Bafiz' Information Resources at SINP . ... Information Services . ... Space Physics Information Home Page . The Centre for Photonuclear Experiments Data (Centr Dannykh Fotoyadernykh Eksperimentov, CDFE)" . Data Services . Data Base of Low Altitude Space Radiation Environment (DB LASRE SINP MSU) . Space Physics Data Archives . Space Physics Data On-Line Services . ... This Page is developed at Laboratory of Computational Mathematics, . ...

Еще в разделе: (Показать все результаты (>10) - dbserv.sinp.msu.ru/ )

• BAFIZ
• 3d Map Description

. Перейти к содержимому . Меню и виджеты . открыть | закрыть Найти: . +7 (495) 939-3038 . aislepkov physics.msu.ru . Ваш e-mail не будет опубликован. Обязательные поля помечены * . Имя * . E-mail * . Сайт . Комментарий . Можно использовать следующие HTML -теги и атрибуты: <a href="" title=""> <abbr title=""> <acronym title=""> <b> <blockquote cite=""> <cite> <code> <del datetime=""> <em> <i> <q cite=""> <strike> <strong> . Сайт работает на WordPress

Еще в разделе: (Показать все результаты (>2) - aislepkov.phys.msu.ru/ )

Научно-образовательный центр Геномного секвенирования МГУ . ... Sep 11, 2014, 9:17 AM . Yegor Bazykin attached NGS_supported_list.pdf to Результаты конкурса NGS-проектов . ... Yegor Bazykin deleted attachment NGS_supported_list.pdf from Результаты конкурса NGS-проектов . ... Yegor Bazykin edited Конкурс NGS-проектов . ... Yegor Bazykin created Результаты конкурса NGS-проектов . Jul 5, 2014, 2:53 AM . Yegor Bazykin updated polozhenie.pdf . ... Recent Site Activity | ...

Еще в разделе: (Показать все результаты (>2) - genseq.fbb.msu.ru/ )

• Page not found - НОЦ геномного секвенирования ФББ МГУ

Страница поиска . Match: All Any Boolean Format: Long Short Sort by: Score Time Title Reverse Score Reverse Time Reverse Title . Search:

Еще в разделе: (Показать все результаты (>4) - www.radio-msu.net/ )

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>6) - mouse.genebee.msu.ru/ )

Welcome to ASC14 To whom it may concern With the supports from the High Performance Computing (HPC) experts and organizations, the ASC13 Student Supercomputer Challenge has concluded with great success. ... We are calling for registration and preliminary contest preparation. ... Some of them may finally take HPC as a career option, such as some students from National Defense University team have already contributed to the Tianhe-1A and Tianhe2. ... Award Overall Gold Winner: 100K RMB (~16000 USD) . ...

294. The Laboratory of Historical Information Sciences

295. A Brief History of Chernogolovka

296. MSU Science Park - Companies

297. Лаборатория биофизики клетки: Объявления о семинарах и др.

298. Интернет

299. http://www.antropos.msu.ru/vestnic/e2013_3.doc

300. Сектор информатики и биофизики сложных систем