BS - 2D data processing program. BS is a windows version of the 2D X-ray data processing program BSL in use at the Daresbury Synchrotron radiation source, for the treatment of low angle diffraction data. ... It requires less memory, has separate window to see 1D graphics and allows export of the image in two common formats: BMP and TIFF. ... information about the data file .adc . add a constant to selected range in n frames from file .add . weighted addition of two images .arg . ...
ABSOLUTE PROPER MOTIONS OF 331 OPEN CLUSTERS . ... The proper motions of stars in the fields of 331 open clusters were taken from Four-Million Star Catalog (4M-catalog) of positions and proper motions (Volchkov et al. ... The absolute proper motions for 21 young open clusters have been derived by comparison of precise relative proper motions of individual stars and their corresponding absolute proper motions. ... Sign of proper motions in RA . ... 0.0001 arcsec/yr . ... rms error in RA proper motion . ...
Сайт кафедры биофизики физического факультета МГУ . ... Студентам . ... Программы курсов . ... Кафедра биофизики поздравляет студентов и сотрудников с началом 2015-2016 учебного года! ... Кафедра биофизики продолжает работу семинаров для студентов младших и старших курсов . ... Выступление Свешниковой А.Н. љ Семинар для студентов 1-2 курсов БИОФИЗИКА: 21 ВЕК 13 апреля 2016 г. (в СРЕДУ) в 15-20 (ауд. 5-68) к.ф.-м.н. Свешникова А.Н. "Что такое Systems Biology? ... Межфакультетский курс "Биофизика". ...
Sites . ... By submitting this form, you are alerting the Google Sites team that this site has content that is in violation of our Terms of Use . If you own the copyright to content on this Site and would like it removed, please see our instructions for notification of copyright infringement . ... This Site contains spam. This Site contains phishing. ... This Site promotes violence or has hate speech. ... This Site contains content that otherwise violates Google Sites Terms of Use . ...
русский english MSU of Lomonosov Higher School . of Policy in Culture . and Administration in Humanities (faculty) . ... Faculty in the people . ... The faculty educational programs (? ... Art business ?) give students an opportunity to get fundamental specialized training and become highly qualified specialists in the sphere of administration in sport and culture. ... Higher School of Policy in Culture and Administration in Humanities (faculty Lomonosov Moscow State University) 2016 . ...
... Поездка в подмосковный поселок Кучино (г. Железнодорожный), в котором Андрей Белый жил с 1925 г. по 1931 г. Мероприятие проводится совместно с Комитетом по культуре администрации г. Железнодорожный. ... Презентация книги директора ЦБС З.И. Голощаповой 'Кучинский остров Андрея Белого' (М., 2005) в литературном музее при библиотеке. ... Экскурсия по музею 'Дом Андрея Белого'. ... Зинаида Ивановна Голощапова (ЦБС им. Андрея Белого г. Железнодорожный) - Кучинский период жизни и творчества Андрея Белого ...
... Вт Фев 10 15:18:12 MSK 2009 . Следующее сообщение: PARALLEL.RU - Новости, специальный выпуск [17/02/2009] . ... Выпуск 259 . 10 февраля 2009 г. ------------- ЧТО НОВОГО? http :// parallel.ru /about/whatsnew.html + Выложена страница Основная схема быстрого преобразования Фурье . http ://fpga.parallel.ru/fft + В разделе, посвященном компьютерам с реконфигурируемой архитектурой на основе ПЛИС выложены новые статьи на странице Публикации по проекту . http ://fpga.parallel.ru/ ...
... For the investigations of the phenomenon leading to non inflation (squidding) of parachute, the influence of canopy permeability and upstream flow on the character of pressure distribution along framework model, imitating round parachute, was studied experimentally. ... The pressure sensors: 13 ones inside and 13 - outside the canopy have been placed for the study of distribution of internal and external pressure on the surface of the model. ... Variant 1. ... Parachute Science] . ...
... Lorem ipsum dolor sit amet, consectetur adipisicing elit, sed do eiusmod tempor incididunt ut labore et dolore. ... Badge Lorem ipsum dolor sit amet, consectetur adipisicing elit, sed do eiusmod tempor incididunt ut labore et dolore. ... Warp comes with a sophisticated layout system to create any kind of sidebar or widget layout. ... Each position has its own layout. ... Lorem ipsum dolor sit amet, consectetur adipisicing elit, sed do eiusmod tempor incididunt. ...
... Subject to the MOIP Charter both natural and legal persons may become the members of the Society upon paying admission fees and acknowledging the Charter and program documents. ... Persons may be elected as the Society?s full and corresponding members on a show of hands at the Society?s Council (Presidium) meeting if nominated by a section and recommended by at least two full Society?s members. ... The Society?s full members have the following rights: . ... 2015 Moscow Society of Naturalists . ...
... Recreational Geography and International Tourism . ... Physical Geography and Landscape Science . ... Science . ... According to the fact that ecological conflicts has a global scale in international watersheds, transboundary location of Selenga river complicates the problem of scientific resolution of the conflicts between water consumers. ... International programme in Natural Resource Management and Law offers a unique combination of Natural and Environmental Sciences and Science of Law. ...
... Кафедра системного анализа ВМК МГУ . ... О кафедре . ... на кафедру . ... ВМК . МГУ . ... СМУ ВМК . ... Alexandr Borisovich Kurzhanski) . In Russian . ... Kurzhanski was Elected Associate Member of USSR Academy of Sciences (now changed to Russian Academy of Sciences) in 1981 and Full Member in 1990. He is the Chairman of the Russian National Committee on Automatic Control (the IFAC NMO). ... Chairman of Russian National Committee of Automatic Control. ... 4 (8). pp. 100-118. (in russian). ...
Заведующий кафедрой Head of the Chair . ... История кафедры . ... В 1966 г. для расширения ведущихся на кафедре научных работ в НИИ Ядерной физики МГУ был создан отдел физики плазмы (ОФП), в 1989 году переименованный в отдел микроэлектроники (ОМЭ). ... Сегодня по различным научным направлениям, ведущимся по специальностям, преподаваемым на кафедре атомной физики, физики плазмы и микроэлектроники, работает около 100 научных сотрудников, среди которых 12 докторов наук и около 50 кандидатов наук. ...
... Unit I. Geologic Hazards and Man Unit II. ... Amazing Earth. ... Трансформируйте словосочетания в предложения. 1. geologic processes going on for millions of years 2. any geologic process can become a geologic hazard 3. some geologic hazards having resulted in disaster 4. many geologic hazards have affected the activity of man 5. a lot of earthquakes resulting in landslides 6. some naturally occurring hazards 7. many disasters are caused by geologic hazards 8. some ...
[
Текст
]
Ссылки http://www.geol.msu.ru/obsh/uch_ch2.doc -- 389.0 Кб -- 08.04.2016
[
Текст
]
Ссылки http://geol.msu.ru/obsh/uch_ch2.doc -- 389.0 Кб -- 08.04.2016 Похожие документы
... Новости . ... О кафедре . ... Занятия в среду 7.11.2012 по Современным компьютерным технологиям (преподаватель Краев А.В.) на первой паре не состоится и переносится в связи с календарным отпуском преподавателя. ... Автор: Краев Андрей Владимирович 06.11.2012 . ... Будут заслушены доклады Аристова А.И., Карамышевой Т.В., Краева А.В., Будановой А.В. Автор: Фурсов Андрей Серафимович 27.10.2012 . ... Colin Angle - основателя и руководителя компании iRobot, крупного специалиста в области робототехники. ...
... TELLING AMERICA'S STORY: NARRATIVE FORM AND THE REAGAN PRESIDENCY WILLIA M E LEWI S By 1980 , Americ a ha d los t its sense of direction . ... The n Ronal d Reaga n cam e ont o th e scene wit h a visio n of America that reinvigorate d th e nation . ... NARRATIV E FOR M I N REAGAN' S RHETORI C Reaga n tells tw o kind s of stories tha t differ in scale an d purpose , but that wor k togethe r to establish th e dominanc e of narrativ e form in th e creation and in th e interpretatio n of his rhetoric . ...
... О хоре . История хора . ... Выступление Академического хора МГУ в Крокус Сити Холле . ... Епископ Тихон открыл выступление хора МГУ в Вене . Хор МГУ выступил в Венском отделении ООН . Выступление хора на торжественном открытии Международного научного конгресса ?Глобалистика ? 2015? ... Академический хор Московского государственного университета имени М. В. Ломоносова . ... Прослушивания состоятся в течение всего сентябряљв 311 и 316 классах Культурного центра МГУ в 18-30 . ...
... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...
[
Текст
]
Ссылки http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/poster_mccmb_2011.pdf -- 225.5 Кб -- 21.07.2011 Похожие документы
... Abstract A Uniform Resource Identifier (URI) is a compact string of characters for identifying an abstract or physical resource. ... This document defines a grammar that is a superset of all valid URI, such that an implementation can parse the common components of a URI reference without knowing the scheme-specific requirements of every possible identifier type. ... URI-reference = [ absoluteURI | ... Otherwise, the reference URI's scheme is inherited from the base URI's scheme component. ...