Центр коллективного пользования . МГУ им. М.В. Ломоносова . ... Главная страница . О центре . ... Уже несколько лет в МГУ действует Центр коллективного пользования, объединивший передовые лаборатории естественнонаучных факультетов МГУ, в распоряжении которых имеется самое современное оборудование. ... Центр коллективного пользования МГУ им. М.В. Ломоносова, 2009 . ...
... The linguistic aspects of the model and the properties of the semantic dictionary ensuring the content analysis with compression of the text structure are considered. Our dictionary resources serve an instru- ment for building a multilevel textual semantic structure. ... Reason (A,B), where SemF(A) = SIT or a whole semantic formula; the same for SemF(B). ... Sem(SIT)R . ... Semantic Resources for Textual Content Compression // Fourth International Conference on Meaning-Text Theory (MTT'09). ...
... hall in front of room 01, MSU, Main Building . ... room 01, MSU, Main Building . ... Silvia Chelala (Empire State College, State University of New York, Old Westbury, New York, USA) Designing and Teaching Introductory Spanish as a Foreign Language at a Distance . ... FFL, recreation hall, 3rd floor . ... FFL, room 519 . ... FFL, room 501 . ... FFL, . room 107-108 . ... Internet-Supported Teaching . ... FFL, room 106 . ... FFL, room 416 . ... FFL, room 420 . ... FFL, room 210 . ...
... Полная версия: Костюмы Грации . Грация-МГУ::Форум > Общение > Общение . Aspirant . Mar 18 2013, 15:51 . ... можно ли заказать костюмы другого цвета? ... Да, и есть ли официальные цвета клуба и эмблема? ... см ссылку http://market.yandex.ru/model?modelid=1043...405413636364720 ) . ... Пример цветов тут: http://4.bp.blogspot.com/-dcHK-yXmFQQ/TcsF.. ... Цитата(Aspirant @ Mar 18 2013, 16:51) . ... Заказать можно, только это не будет клубным костюмом Грации. ...
... 11:00-11:30 Break 11:30-12:00 Lecture 3 Prof . Heinz Oberhammer , Institute of Physical and Theoretical Chemistry , University of Tubingen, Germany Structures and Conformations of Disilacyclohexanes 12:00-12:30 Lecture 4 Prof . Ingvar Arnason , University of Iceland, Iceland Energetics and Potentional Energy Surfaces of Disilacyclohexanes 12:30-13:00 Lecture 5 Prof . Igor Godunov, Chemistry Department , MSU , ...
... Сотрудники . ... Научная работа . ... Сверхпроводимость вызывает огромный интерес, т.к. передача электрического тока без энергетических потерь сулит огромные перспективы. Актуальность поиска соединений для электрохимической интеркаляции мультивалентных катионов, также как и разработки фундаментальных основ кристаллохимического дизайна таких соединений, связана с возрастающими потребностями в легких высокоэффективных возобновляемых химических источниках тока (ХИТ). МГУ им. М.В. Ломоносова . ...
... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...
[
Текст
]
Ссылки http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/poster_mccmb_2011.pdf -- 225.5 Кб -- 21.07.2011 Похожие документы
О кафедре . ... Динамические задачи теории упругости . Динамика пластин и оболочек . ... Методы теории упругости . ... Нелинейная теория упругости . ... Пластины и оболочки . ... Теория и расчет оболочек тонкостенных летательных аппаратов . ... Теория упругости структурно-неоднородных тел . ... Уравнения изгиба пластин классическая линейная теория. ... Колебания пластин. ... Oscillation of plates . ... МГУ им. М.В.Ломоносова, механико-математический факультет, кафедра теории упругости . ...
... Поиск по МГУ | Лента новостей | ... Форумы > Новости МГУ > Тема . ... Презентация по машинному переводу от Google на коллоквиуме по базам данных в МГУ . 2-го июня в 11:00 во 2-м учебном корпусе МГУ (здание факультета ВМиК МГУ) состоится презентация исследователя из Нью-Йоркского отделения Google на тему: "Building a Large-Scale Machine Translation System" ("Построение масштабируемой системы машинного перевода"). ... 2003 2011 MsuNews.Ru Новости МГУ . ... Экспорт новостей (RSS) ...
Thunderstorms and Elementary Particle Acceleration . ... Conference . The first announcement . ... The Thunderstorms and Elementary Particle Acceleration (TEPA-2012) conference is the second one devoted to the studies of the extreme atmospheric effects connected with amplification of electric fields in the lower atmosphere. ... TEPA-2012 conference will be held from July 9 till July 11, 2012, just after the 23rd European Cosmic Ray Symposium also organized by MSU ( http://ecrs2012.sinp.msu.ru ) . ...
... 000, 113 (2010) Printed 21 September 2011 A (MN L TEX style file v2.2) A universal ultraviolet-optical colourcolourmagnitude relation of galaxies I1gor V. Chilingarian1,2, and Ivan Yu. ... Received 2011 Sep 15; in original form 2011 Feb 6 ABSTRACT The bimodal galaxy distribution in the optical colourmagnitude diagram (CMD) comprises a narrow "red sequence" populated mostly by early-type galaxies and a broad "blue cloud" dominated by star-forming systems. ...
... We thank the Swift team for their rapid scheduling of this observation. ... 2455705.20851 V 14.15 0.03 2455707.83079 V 14.10 0.03 2455710.84028 V 13.53 0.02 2455713.64631 V 13.66 0.02 2455714.65479 V 14.11 0.03 2455714.71823 V 14.12 0.02 2455714.78596 V 14.20 0.02 2455717.39593 V 14.37 0.03 2455726.62861 V 14.83 0.04 2455727.16343 V 14.57 0.04 2455730.50586 V 14.57 0.03 2455730.57329 V 14.56 0.03 2455730.70360 V 14.66 0.04 2455738.32865 V 14.00 0.02 2455742.86146 V 14.21 ...
ITPM MSU . Quantum Computing Page . ... Quantum Computation/Cryptography at LosAlamos . Quantum Information at Los Alamos National Laboratory . Laboratory for Theoretical and Quantum Computing ( Universite de Montreal ) . Quantum information and quantum computation at IBM . ... Centre for Quantum Computation . Quantum Information Page . Quantum Information and Computation . ... Quantum Information and Quantum Computing (by Reinhard F. Werner) . ... c) ITPM MSU 1998, 1999 ...
... Практически единственной возможностью устранения катаракты является операция по извлечению помутневшего хрусталика и введению интраокулярной линзы (ИОЛ) для восстановления фокусировки видимого излучения на сетчатку [1] . На сегодняшний день существует множество видов ИОЛ, отличающихся по форме, размерам, материалу, из которого они изготовлены, а также весом, цветом, способами фиксации на глазу и пр. [2] . ... модель ИОЛ . ... БЕЛОФТООПТИКА модель D . ...
... Place: A private EE centre (Laboratory for Optimization of Nature Exploitation LONE) and public kindergartens at Pushchino in the Moscow region. Target groups: Pre-school age children (3-6), school children (9-15), kindergarten teachers. ... In the second phase training was provided to all kindergarten teachers who volunteered to participate in the project as well as for 20 school children selected during practical courses, lectures and seminars. ...
... THE TIME HAS COME FOR "THUNDER BOOKS" . ... You may have forgotten what a thunder book is, or maybe you didn't ever use that name. ... It is a handy reference to those things you need to know about soils and how they behave. ... Well, if you knew how to use them as pages in a thunder book it would surely be a good start, but you need something uniquely yours. ... It has always been my belief that the mission of a soil survey is to help people understand and wisely use soil resources. ... Good read. ...
. Laboratory Head: L.K.Gladilin, tel: (+7 495) 939 3568 , fax: (+7 495) 939 3064 , . Сотрудники Лаборатории (LHPR staff) . Web-pages: . L.K.Gladilin , . V.I.Rud , . I.A.Korzhavina , . Information for our Guests . Справка о создании и первом периоде работы лаборатории, подготовленная в 1980 г. Research Activities: . Scientific Information Search Engines : inSPIRE , ScienceResearch , Google Scholar . Scientific Servers : Interactions , AIP , Elements , Scientific . Feedback: Last modified on March 1, 2016.
Available on CMS information server CMS NOTE 2000/065 The Compact Muon Solenoid Experiment Mailing address: CMS CERN, CH1211 GENEVA 23, Switzerland CMS Note ``SingleTop'' an event generator for the single top quark production at the LHC. ... But this process has sufficiently different signature which is similar to the top quark pair production signature. ... The events for the two main processes of the single top quark production at the LHC are available in the CMS processes data base PEVLIB [14]. ...
... News . ... Карта сайта . ... Password * . Request new password . 8 January 2015 - 11:39 . ... Старая версия сайта . Первый почтовый сервер . Второй почтовый сервер . 2016 Механико-математический факультет МГУ им. М.В. Ломоносова . О сайте . ...