Научно-образовательный центр Геномного секвенирования МГУ . ... Sep 11, 2014, 9:17 AM . Yegor Bazykin attached NGS_supported_list.pdf to Результаты конкурса NGS-проектов . ... Yegor Bazykin deleted attachment NGS_supported_list.pdf from Результаты конкурса NGS-проектов . ... Yegor Bazykin edited Конкурс NGS-проектов . ... Yegor Bazykin created Результаты конкурса NGS-проектов . Jul 5, 2014, 2:53 AM . Yegor Bazykin updated polozhenie.pdf . ... Recent Site Activity | ...
... An approach to the hybrid quantum mechanical and molecular mechanical (QM/MM) theory based on the effective fragment potential (EFP) technique (M. Gordon and co-authors) for modeling properties and reactivity of large molecular systems of biochemical significance is being developed. Currently we are preparing a novel version of the computer program based on the most recent variant of the PC GAMESS quantum chemistry package (A. A. Granovsky) and the TINKER molecular modeling package (J. Ponder). ...
Contents Curricula, and Programs. Mathematical Analysis. (The Program of Mathematical Physics Department).............................................. Algebra and Analytical Geometry.(The program of (General "Mathematics" Department)................................ Computer and Programming. (The program of Algorithmic Languages Department).................................... The practical work on Computers.( Department of Algorithmic. Languages)............................................... Discrete
[
Текст
]
Ссылки http://mph.cs.msu.ru/mph/arh/blank/1999pro-en.doc -- 190.5 Кб -- 17.02.2011
[
Текст
]
Ссылки http://mph.cs.msu.su/mph/arh/blank/1999pro-en.doc -- 190.5 Кб -- 17.02.2011
[
Текст
]
Ссылки http://mph.cmc.msu.ru/mph/arh/blank/1999pro-en.doc -- 190.5 Кб -- 17.02.2011 Похожие документы
... The students of the Faculty of Geography study territorial distribution and spatial development patterns of various natural phenomena as well as social and economic objects. ... The academic program includes courses with lectures, seminars, laboratory and field training in natural sciences and humanities which form 4 blocks: . ... In addition to the field stations of the Faculty, the students have an opportunity to have their field training in scientific institutions and different companies. ...
... Only by numerical simulation. ... moment T (K) Dipole moment (D) Experiment Other example: Diffusion constant 200 250 298 350 400 2.40 2.37 2.48 2.59 2.80 2.25 The Distribution functions: radial distribution function 1 g (r) = N t =1 j i N TS N pair ( r - rij ) The Distribution functions: radial distribution function CC def 2 Work mode computer related 1) · Perform simulation , create trajectory file · Calculate properties timestep by timestep 2) · Perform ...
Cell Biology International 27 (2003) 293294 Cell Biology International www.elsevier.com/locate/jnlabr/ycbir Short communication Microtubule dynamics in living cells : direct analysis in the internal cytoplasm Ivan A. Vorobjev a a,* , Irina B. Alieva a, Ilya S. Grigoriev b, Gary G. Borisy c Laboratory of Cell Motility, A.N. Belozersky Institute, Moscow State University, Moscow, Russia b Department of ... These data demonstrate that MT growth is impeded at the cell margin. ...
[
Текст
]
Ссылки http://cellmotility.genebee.msu.ru/html/articles/Vorobjev03.pdf -- 67.3 Кб -- 04.03.2004 Похожие документы
This domain may be for sale - этот домен возможно продается . ... The gathered information about your visits to this and other websites are used by these third party companies in order to provide advertisements about goods and services of interest to you. ... If you would like more information about this practice and to know your choices about not having this information used by these companies, click here . ...
Network Working Group T. Berners-Lee Request for Comments: 1945 MIT/LCS Category: Informational R. Fielding UC Irvine H. Frystyk MIT/LCS May 1996 Hypertext Transfer Protocol -- HTTP/1.0 Status of This Memo This memo provides information for the Internet community. This memo does not specify an Internet standard of any kind. Distribution of this memo is unlimited. IESG Note: The IESG has concerns about this protocol, and expects this document to be replaced relatively soon by a standards track document.
... Soc. 376, 10331046 (2007) doi:10.1111/j.1365-2966.2007.11549.x Kinematics and stellar populations of the dwarf elliptical galaxy IC 3653 I. V. Chilingarian,1 1 2 ,2,3 P. Prugniel, 2,4 O. K. Sil'chenko1 and V. L. Afanasiev 5 Sternberg Astronomical Institute of the Moscow State University, Universitetsky pr. ... Fitting the spectra with synthetic single stellar populations (SSP), we found an SSPequivalent age of 5 Gyr and nearly solar metallicity [Fe/H] =-0.06 dex. ... 2007 The Authors. ...
... Specialist degree . ... Master degree . ... Master variants . ... About Faculty . ... Mechmath faculty admission resumed its work and is actively preparing for the new reception 2015! ... Read more about Schedule in June . ... The Dean of Mechanics and Mathematics Faculty, the head of the Department of Mathematical and Computer Analysis Methods, professor Vladimir Chubarikov ; . ... Read more about The Open Day . ... 2016 Mechmath admission for internetional students ...
... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...
[
Текст
]
Ссылки http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/poster_mccmb_2011.pdf -- 225.5 Кб -- 21.07.2011 Похожие документы
... General Information . ... For physics faculty . ... Until 1939 in Moscow State University there was one undivided General Physics Chair. ... He was a leading scientist in the field of magnetic phenomena, and during 14 years the experimental and theoretical research of condensed matter magnetization, magnetic hysteresis and ferromagnetic resonance have been conducted under his leadership. ... In 2003 the Chair was renamed to Chair of General Physics and Magneto-Ordered Matter. ...
IV чемпионат проекта 'Воздушно-инженерная школа (Cansat в России)'. Дубна и Талдомский р-н, 01.07.20 . С 29 июня по 4 июля 2015 года в г.Дубна (филиал НИИЯФ МГУ) и Талдомском районе Московской области будет проходить 4-й ежегодный чемпионат проекта 'СanSat в России'. ... Ссылка на предыдущие соревнования: http://www.msu.dubna.ru/main/index.php?option=com_content&task=view&id=77&Itemid=1 . ... Открытие в филиале НИИЯФ МГУ (Дубна, ул. Ленинградская д. 12), публичные . ...
JOURNAL OF APPLIED PHYSICS VOLUME 96, NUMBER 1 1 JULY 2004 Theoretical analysis of the synergism in the dielectric strength for SF6 у CF4 mixtures A. V. Larin ґ Laboratoire de Physico-Chimie Informatique, Facultes Universitaires Notre-Dame de la Paix, Rue de Bruxelles 61, B ... Calculated electron energy distribution function EEDF for the SF6 /CF4 mixture solid lines and a pure CF4 dashed lines or b pure SF6 dotted lines vs the electron energy under the same E / N values as given in Table IV. ...
... Snecma Moteurs (Groupe Snecma, France) . ... The Colloquium-458, organized by EUROMECH , will take place at Institute of Mechanics of Lomonosov Moscow State University (MSU) . ... The subjects of the Colloquium-458 cover important problems dealing with the verification of constitutive equations, the organization of experiments, the connection between microstructures and mechanical properties and the effective utilization of the modern FEM packages. ... France. ... S.-Petersburg State Techn. ...
Laboratory of Microfluidics and Nanofluidics . Laboratory of Physical Chemistry of Modified Surfaces . ... Research . ... Laboratory of Micro- and Nanofluidics . ... Professor B.V.Derjaguin moved to the Laboratory with his research group as an Emeritus Professor. ... In 1993 Professor Olga I. Vinogradova took over the leadership of the Laboratory. In 2009 the Laboratory of Micro- and Nanofluidics was organized by Professor Olga I. Vinogradova at the Physics Department of the M.V.Lomonosov MSU. ...
... MATHEMATICAL AND SYSTEM BIOLOGY UDC 577.1 Membrane Profile-Based Probabilistic Method for Predicting Transmembrane Segments via Multiple Protein Sequence Alignment R. A. Sutormina and A. A. Mironova a b , b, c State Research Center GosNIIgenetika, Moscow, 117545 Russia; e-mail: sutor_ra@mail ... Bioinformatics, Moscow State University, Moscow, 119992 Russia Received January 25, 2006 Abstract--Prediction of transmembrane (TM) segments of amino ... Protein Sci. ... Proteins. ...
[
Текст
]
Ссылки http://storage.bioinf.fbb.msu.ru/~roman/mol_biol_mosk_2006.pdf -- 151.6 Кб -- 25.05.2006 Похожие документы
Home Search Collections Journals About Contact us My IOPscience On the Routh sphere problem This content has been downloaded from IOPscience. ... 2013 J. Phys. A: Math. ... It allows us to relate the nonholonomic Routh system with the Hamiltonian system on a cotangent bundle to the sphere with a canonical Poisson structure. ... If the Hamiltonian vector field X has the form (1.4) with respect to the second Poisson bivector, we have the so-called quasi-bi-Hamiltonian system. ... 4 J. Phys. A: Math. ...
Заведующий кафедрой Head of the Chair . ... История кафедры . ... В 1966 г. для расширения ведущихся на кафедре научных работ в НИИ Ядерной физики МГУ был создан отдел физики плазмы (ОФП), в 1989 году переименованный в отдел микроэлектроники (ОМЭ). ... Сегодня по различным научным направлениям, ведущимся по специальностям, преподаваемым на кафедре атомной физики, физики плазмы и микроэлектроники, работает около 100 научных сотрудников, среди которых 12 докторов наук и около 50 кандидатов наук. ...