... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...
[
Текст
]
Ссылки http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/poster_mccmb_2011.pdf -- 225.5 Кб -- 21.07.2011 Похожие документы
Magnetism Department MSU . ... Research groups . ... Students . Phd students . ... The basics of spintronics. prof . Vedyaev ю. Actual problems in modern magnetism . prof . Granovsky A. The physical basics of magnetism . associate prof . Kotel'nikova O. Magnetic phase transitions. associate prof . Kotel'nikova O. Physics of magnetic phenomena. associate prof . Kotel'nikova O. Introduction in group theory and its application in physics of magnetic phenomena. associate ...
... The circular sidewall of the layer was made of plexiglass. ... This is in contrast to the situation of horizontal layer where longitudinal magnetic field doesn't influence on convective instability and only renders oriented effect [8,10]. [ pic ] Figure 6 Stability boundaries of thermally driven shear flow in an inclined ferrofluid layer in the presence of a longitudinal magnetic field : a - shear flow ; b - convection rolls aligned with the shear flow ; c - convection ...
... 18 ' декабря 2000 г. Информационно-вычислительная сеть Химического факультета МГУ является комплексной инженерно-технической системой, служащей для обмена информацией между компьютерами факультета и узлами сети Internet . ... Управление всеми узлами одной кафедры (подразделения) факультета обеспечивает администратор сети кафедры , назначаемый заведующим кафедрой. ... ознакомление администраторов узлов с положением о сети факультета и правилами пользования сетью MSUNet . ... Администратор узла: . ...
... М.: ИНФРА-М, 1998 -640 с.Тираж закончен. ... Макаров А.А. Анализ данных на компьютере. ... Кулаичев А.П., . ... совершенствование и качественное улучшение преподавания дис-циплин, включающих статистическую обработку, анализ и модели-рование данных; . облегчение и улучшение восприятия теоретических основ обработ-ки и анализа данных по широкому кругу специальностей; . ... Кулаичев А.П. Методы и средства комплексного анализа данных. ... Кулаичев А.П. Компьютерный контроль процессов и анализ сигналов. ...
The Database of Close Binary Systems . ... Team . ... This web-based interactive database is being developed and maintained by a team at the Sternberg Astronomical Institute of the Moscow State University . The project is an on-line extension of our catalogue on "Highly Evolved Close Binary Stars" (volumes I, II) published by Gordon and Breach in 1996. As of September 2009, the database (both the software and the content) is in its development/testing phase. ...
This domain may be for sale - этот домен возможно продается . ... The gathered information about your visits to this and other websites are used by these third party companies in order to provide advertisements about goods and services of interest to you. ... If you would like more information about this practice and to know your choices about not having this information used by these companies, click here . ...
WEB- . ... 495) 939 5560. 1 30 . ... 2) : A. IGAMBERDIEV ( ). Igamberdiev AU (2012) Physics and Logic of Life. ... BioSystems 109: 336-345, Igamberdiev AU (2008) Objective patterns in the evolving network of non-equivalent observers. BioSystems 92: 122-131, Igamberdiev AU (2007) Physical limits of computation and emergence of life. ... BioSystems 77: 47-56.) ... 1 - : DLF- TSK- ». DLF- [Le-11] D, L, F. D (http://math.bu.edu/people/levit/mem-segal.pdf), L " ", F " ". ... DLF - . ...
... Главная Факультет политологии Новости факультета Новость . ... С 1 по 3 апреля 2014 года с успехом прошла третья ежегодная межфакультетская студенческая научно-практическая конференция на английском языке ?Актуальные проблемы политологии и философии на современном этапе?. В конференции приняли участие 60 студентов: 48 студентов 1, 2 и 3 курсов факультета политологии и 12 студентов 1 и 2 курсов философского факультета. ... Политология России . ... Поступление на факультет политологии в 2016 году . ...
The Day the World Changed Vocabulary Expressions I Task1. ... Nazi war criminals committed appalling atrocities during World War II. 2.debris a quality of being well known for evil, esp. morally wicked actions. After the bombing there was a lot of debris everywhere. 3.resolve an act of great evil, esp. cruelty, shocking, terrible. ... He didn't seem daunted by the difficulties facing him. 9.infamy smth that needs attention, consideration, service, being more important than anything else. ...
[
Текст
]
Ссылки http://www.eng.math.msu.su/download/The_Day_The_World_Changed_article_and_vocabulary.pdf -- 1103.7 Кб -- 02.10.2011 Похожие документы
? ? 1.???????????????? 3 2.Реформа и инновации в сфере государственных услуг в России. 8 3.Особенности развития экономики Шэньчжэня 26 4.в условиях модификации модели роста в КНР 26 5.???????????????? 39 6.СРАВНИТЕЛЬНЫЙ ОПЫТ УЧАСТИЯ РОССИИ И КИТАЯ В ИНСТИТУТАХ ГЛОБАЛЬНОГО УПРАВЛЕНИЯ 41 7.Принципы развития межрегиональных центров подготовки кадров для государственного управления в Российской Федерации 59 8.??????????????? 74 9.Региональные особенности государственного регулирования сферы образования в РФ 82
... Coordination of economic policies and convergence of economic performance are fundamental to the integration of national economies in the Community. ... When U.S. President Barack Obama enters his White House meeting with Israeli Prime Minister Benjamin Netanyahu on March 5 -- angling to dissuade Israel from attacking Iran's nuclear facilities -- there will be one seemingly mundane issue on his mind that he may be too uncomfortable to share with his guest: gasoline prices. ... 2004. ...
... Обучение . ... Проводится запись на очные курсы СУНЦ МГУ на 2011-12 учебный год . ... ФМШ.ру - обучение одаренных детей . ... Победители олимпиады, школьники 9-10 классов, получат возможность принять участие во вступительной олимпиаде СУНЦ МГУ 20 марта и, в случае победы в ней, поступить в СУНЦ МГУ досрочно . МЦНМО и СУНЦ МГУ проводят в субботу, 27 февраля 2010 года интернет-олимпиаду по математике для учащихся 9-11 классов. ... СУНЦ МГУ школа им. А.Н.Колмогорова . ...
. NON-STATIONARY OPERATION OF THE FAST-FLOW LASERS . AND NEW POSSIBILITIES OF CONTROLLING THE LASER OUTPUT CHARACTERISTICS . A.V. Mushenkov, A.Yu.Loskutov, A.I.Odintsov, A.I.Fedoseev and V.F.Sharkov . Physics department of M.V.Lomonosov Moscow State University, 119899, Vorob'evy gory, Moscow, Russia . Abstract . The dynamics of the lasing of the fast crossflow gas laser with the inhomogeneous steady state pumping in the unstable resonator by means of numerical modeling is investigated. Depending on the
... Метафоры, которыми мы живем . ... МИР ПОНЯТИЙ, ОКРУЖАЮЩИЙ НАС . ... букв.: ... Ориента-ционные метафоры придают понятию пространственную ориентацию; например, HAPPY IS UP 'СЧАСТЬЕ ЕСТЬ ВЕРХ'. ... Например, эмпирическое основание метафоры БОЛЬШЕ - ВЕРХ весьма существенно отличается от эмпирического основания метафор СЧАСТЬЕ - ВЕРХ или РАЦИОНАЛЬНОЕ - ВЕРХ. Хотя во всех этих метафорах фигурирует одно и то же понятие ВЕРХ, области опыта, на которых основаны эти метафоры, существенно различны. ...
MOSCOW STATE UNIVERSITY The Scientific Society of students of the Law Faculty January 25, 2014 1- The flyer of the Unit `Jurisprudence' of International scientific conference "Lomonosov - 2014" 1. ... The organizers of the Unit are the law faculty of Moscow State University and the Scientific Society of students of the law faculty. ... Administrative law 2. ... The Organizing Committee: Presiding Officer Kozlova Natalya Vladimirovna (Deputy Dean of Law Faculty on study, Doctor in Law, Professor). ...
[
Текст
]
Ссылки http://law.msu.ru/bitcache/bc6ca81fd934d7083472270ea392667daf49eebb?vid=30191&disposition=attachment&op=download -- 260.2 Кб -- 28.02.2014 Похожие документы
MOSCOW STATE UNIVERSITY The Scientific Society of students of the Law Faculty January 15, 2013 1 - The flyer of the Unit `Jurisprudence' of International scientific conference "Lomonosov - 2013" 1. ... Administrative law 2. ... Members of the Council of Experts: Golichenkov Alexander Konstantinovich (Head of the Law Faculty, head of the chair of land and ecological law, Doctor in Law, Professor) Romanov Stanislav Vladimirovich (Deputy Dean on instructional work, Candidate in Law, Docent). ...
[
Текст
]
Ссылки http://www.law.msu.ru/bitcache/da2ecb4c4c1ad0c8d4c795e346afcf80b93bd045?vid=25267&disposition=attachment&op=download -- 302.6 Кб -- 25.02.2013 Похожие документы
... Кафедры . ... Практика . Производственная практика 2015 . ... IS PLEASED TO WELCOME INTERNATIONAL STUDENTS TO . ... International students enjoy both a regular curriculum and an in-depth study of the Russian Language, Russian Culture and History of Russia. ... a certified Russian translation ofљ both the original of Secondary School Certificate (or equivalent) and its attachment. ... a certified copy of ID/passport (the original of ID/passport is to be produced on application) . ...
... Кафедра иммунологии Биологического факультета . ... Страница памяти А.А. Ярилина . ... Опубликовано 16/04/2011 20/04/2011 Рубрики immunology-today Добавить комментарий к записи Лекции Тома Хамильтона 21 и 22 апреля . ... Опубликовано 02/12/2010 29/06/2011 Рубрики immunology-today Добавить комментарий к записи Как Т-клетки узнают антиген . ... Опубликовано 20/09/2010 25/09/2010 Рубрики immunology-today Добавить комментарий к записи Научный семинар в рамках курса ?Актуальные проблемы иммунологии? ...
sparallel.ru . ... Туфли от кристиана лабутина . ... И наконец, рассмотрим Nike Tiempo ? ... это мировой лидер по производству спортивной обуви, а футбольные бутсы nike ? ... Мы предлагаем купить бутсы Найк просто по смешным ценам в Киеве, Донецке, Харькове, Днепропетровске, Одессе, Львове и по всей Украине. ... самая популярная серия бутсы найк купить из футбольной обуви от именитого производителя, которую для себя выбрали Криштиану Роналдо, Златан Ибрагимович, Франк Рибери и другие мировые звезды. ...