... The latter should be taken into account and carefully modeled as a fluid-structure interaction (FSI) problem. A patient- specific FSI analysis is impossible because it predicts only estimated hemodynamic features which are based on assumptions regarding material properties. The objective of this study is to develop a new methodology that assimilates medical imaging data for quantitative hemodynamic data extraction. ...
[
Текст
]
Ссылки http://hit-conf.imec.msu.ru/2012/lectures/Yakhot-abstract.doc -- 21.5 Кб -- 14.06.2015 Похожие документы
... Фуллерены . ... Химия фуллеренов и их производных . Синтез органических производных фуллеренов . ... синтез органических производных фуллеренов[60] и галогенофуллеренов[60], структурные исследования, модификация синтезированными производными фуллерена наноструктурированной поверхности биосовместимых полимеров, биологические испытания . ... 6) Методы нанесения производных фуллерена на поверхность полимеров . ... Copyright 2006-2012, Лаборатория термохимии, Московский государственный университет . ...
... О кафедре . Кафедра суперкомпьютеров и квантовой информатики . ... Кафедра проводит обучение по образовательной программе шестилетней интегрированной подготовки высококвалифицированных специалистов с последовательным освоением образовательной программы бакалавриата (4 года) по профилю ?Системное программирование и компьютерные науки? и образовательной программы магистратуры (2 года) по двум магистерским программам: ?Суперкомпьютерные системы и приложения? и ?Квантовая информатика?. ... ИПМ РАН . ...
JUDGEMENT ON PTOLEMY . ... Ancient Planetary Observations and the Validity of Ephemeris Time. ... Time . ... Lunar, X 9 . ... But Newton, by reasoning he does not explain and we cannot fathom, decides that they must be the work of Euctemon and, he presumes, Meton, and that they must be the result of observation. ... On the other hand, while Newton believes that Meton and Euctemon were very good observers, he does not think highly of Ptolemy's observations, in fact, he believes they are all fraudulent. ...
МГУ имени М.В.Ломоносова Русская версия . ... Bioengineering and Bioinformatics . ... 29 Feb 2016 . ... Russia, Moscow . ... Chairman: Skulachev VP (Dean of the Faculty of Bioengineering and Bioinformatics, Moscow State University); . E xecutive secretary: AV Golovin (Assistant Professor, Department of Bioengineering and Bioinformatics, Moscow State University); . ... 119234, Moscow, GSP-1, Lenin Hills, Moscow State University 1, page 73, Faculty of Bioengineering and Bioinformatics, room 433. ...
BS - 2D data processing program. BS is a windows version of the 2D X-ray data processing program BSL in use at the Daresbury Synchrotron radiation source, for the treatment of low angle diffraction data. ... It requires less memory, has separate window to see 1D graphics and allows export of the image in two common formats: BMP and TIFF. ... information about the data file .adc . add a constant to selected range in n frames from file .add . weighted addition of two images .arg . ...
Volume 163, number 2 FEBS 0973 November 1983 Diazepam inhibits cell respiration and induces fragmentation of mitochondrial reticulum Ivan A. Vorobjev and Dmitry B. Zorov A.N. Belozersky Laboratory of Molecular Biology and Bioorganic Chemistry, Moscow State University, 117234 Moscow, USSR Received 1 August 1983; revised version received 14 September 1983 Diazepam (70-150 µg/ml) significantly inhibits oxygen consumption by pig kidney embryo cells and causes the cellular ATP level to fall. ...
[
Текст
]
Ссылки http://cellmotility.genebee.msu.ru/html/articles/vorobjev83.pdf -- 1055.8 Кб -- 24.05.2002 Похожие документы
The Database of Close Binary Systems . ... Team . ... This web-based interactive database is being developed and maintained by a team at the Sternberg Astronomical Institute of the Moscow State University . The project is an on-line extension of our catalogue on "Highly Evolved Close Binary Stars" (volumes I, II) published by Gordon and Breach in 1996. As of September 2009, the database (both the software and the content) is in its development/testing phase. ...
The Shigeyoshi Matsumae Stadium in Moscow University was opened on September 1, 1989, on the campus of Moscow University, as the first full-scale stadium having artificial turf in the Soviet Union (at that time). ... The stadium was a gift by Tokai University to Moscow University, as the result of more than 20 years of exchange and friendship between Tokai University and Moscow University in exchanging students and teachers, as well as academic and cultural works since 1973. ...
... Also during this work Dian drank a lot of tea with sugar, completed his description of urban and rural life (to the tunes of world-known musical "Notre-Dame de Paris"), wrote several poems about his dear friend GVR. ... Besides this project, Sergei A. Spirin with his colleague Andrew V. Alexeevski takes a very great part in different researches. Near their work room on the 3rd floor of the "A" laboratory building, near with the biological one, different colourful posters can be watched. ...
. Vertical distribution of phytoplankton concentration ( Fo ) -1, photosynthetic activity ( Fv/Fm ) - 2 and primary production (by 14 C method) - 3 in sunny day at diurnal station in central region of Baltic sea. A - 9 a.m., B - 11 a.m., C - 1 p.m., D - 4 p.m., E - 7 p.m. Fluorescence was measured with PrimProd fluorometer. Data were obtained during cruise of r/v Oceania, Institute of Oceanology of the Polish AS in september 1995.
Re: Дрифтерный промысел . SMakeev 06 сентября 2001 00:24:19 . ... Sent: Wednesday, September 05, 2001 3:41 AM . Subject: Re: Дрифтерный промысел . Ecological Cooperation Project***************** . hydro@fadr.msu.ru http://fadr.msu.ru/ecocoop/hydro * . ... Дрифтерный промысел - один из современных способов добычи . ... Меня интересуют, прежде всего, объемы промысла, последствия такого . способа добычи, влияние на экосистемы. ... акций против дрифтерного промысла. ...
A.Nekipelov Modernization of Basic Research in Russia: Russian Academy of Sciences ( RAS ) Vision Joint Session of Russian Academy of Sciences, Institute of France Academy of Sciences and Academy of Technology of France Paris, 2010, September 28 1 RAS in Russian Basic Science Potential (per cent, 2008) Russian Federation Research Organizations 100,0 RAS 12,7 Overall Personnel ... Who is the main actor in research: an institute or a laboratory? ...
Moscow Astronomical Plate Archives: . Contents, Digitization, Current and Possible Applications . ... We describe the astronomical plate archives in Moscow and Zvenigorod and the existing digitization projects. ... 2 The Plate Archive of the Sternberg Institute . The contents of the most important Moscow astronomical plate archive, that of the Sternberg Astronomical Institute, was briefly presented in Shugarov et al. [1] in 1999. ... THE MOSCOW PLATE COLLECTION (STERNBERG INSTITUTE) . ...
Apache License Version 2.0, January 2004 http://www.apache.org/licenses/ TERMS AND CONDITIONS FOR USE, REPRODUCTION, AND DISTRIBUTION 1. ... Licensor" shall mean the copyright owner or entity authorized by the copyright owner that is granting the License. ... Work" shall mean the work of authorship, whether in Source or Object form, made available under the License, as indicated by a copyright notice that is included in or attached to the work (an example is provided in the Appendix below). ...
... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...
[
Текст
]
Ссылки http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/poster_mccmb_2011.pdf -- 225.5 Кб -- 21.07.2011 Похожие документы
звоните, мы в Москве(926)6667253 art-sale@mail.ru . Начало www.99ru.ru Виниловые пластинки Запад 15614 . ... Искусство . История.Философия . ... Художественные . ... История Всемирная . ... Искусство и культура . ... Другие виды искусства . ... Теория искусств.Эстетика . ... Этнография Фольклор . ... Наследие Востока . ... Фольклор . ... СССР (после 1917) . ... Введите код товара из каталога. автор Kraftwerk . ... Западных уже нет, остались кое-какие лицензионные СССР звоните, тел.сверху . ...
Space Weather . ... Space weather . ... Data . ... You should fill in "Workspace" by groups of data sets to create plots. ... Putting different kind of data into the same plot remember, that the first dropped data set chooses and determines the axis scale for all data. ... If you need both kind of scale in the same plot, create two different plots and unite them. The speed of this service depends on 3 components: data processing on server, data transmission and data plotting in your browser. ...
... MTEL-2/RELEC (Telescope T) Instrument: Data Format Current Status . ... BE KNA RELEC . ... PSA-SAS3-Relec instrument, data format current status . ... Radio frequency waves diagnostic on RELEC satellite . ... First results ultraviolet and infrared radiation detector testing on board of the RELEC microsatellite . ...