. BS is free for non-commercial users. I'll be gratefull if you drop me a few lines about yourself before downloading the program (your name, position, affilation, ...) and field of research. DOWNLOAD . bs.zip , includes bs.exe and bs.hlp , ~300 kb . bs.exe - the program, ~ 550 kb . bs.hlp - Windows help file, ~ 50 kb . ALSO AVAILABLE . conv.exe a converter from ESRF KLORA data format to BS .

Еще в разделе: (Показать все результаты (>3) - muscle.imec.msu.ru/ )

Heat transfer intensification on surfaces with 'eddy generating' relief at supersonic velocity of incident flow . ... Temperature field on plates with 'eddy generating' relief (dimples and projections) М=3.1 . Local coefficients of heat transfer distribution on plates with 'eddy generating' relief (dimples and projections) and a smooth plate flown over by supersonic air stream M=3 . ... Temperature distribution during flowing of supersonic stream over a single dimple . ...

Еще в разделе: (Показать все результаты (>6) - termogaz.imec.msu.ru/ )

... Выберите Моя библиотека Библиотека 5.х Эйдос Протокол Z39.50 Библиотека 4.02 -> 5.x Библиотека 4.02 Куб Общие вопросы Сигла Эйдос 4.0 ТрансЭйдос . ... Компания 'Библиотечная компьютерная сеть' разрабатывает и внедряет Автоматизированные библиотечные информационные системы ( АБИС ): каталогизатор книг - создание электронного каталога библиотеки , учет книг . ... 123181, Москва, Ул. Исаковского, д.12, кор.1, Библиотека, ООО "БКС". bks-mgu@yandex.ru . ...

Еще в разделе: (Показать все результаты (>4) - www.bks-mgu.ru/ )

home | ... contacts | Ilyukhina Ekaterina Anatol'evna . ... Organic Chemistry Division, Chemistry Department, Lomonosov Moscow State University, Leninskie Gory, 199899 Moscow, Russia. ... 7(095)939-55-46 . ... Study at the Department of Chemistry, Lomonosov Moscow State University, Moscow Field of scientific interests: . ...

Еще в разделе: (Показать все результаты (>3) - www.mgumus.chem.msu.ru/ )

... Keywords: boundary-layer depth, stable stratification, Ekman layer. ... Experimental data (23) Data sets used in this paper for empirical validation of the proposed SBL depth formulation are taken from three measurement sites ( Figure 1), namely, (i) Cabauw measurement station (Nieuwstadt, 1984; Van Ulden and Wieringa, 1996), (ii) BASIS (Baltic Air-Sea-Ice Study) field experiment (Launiainen, 1999), and (iii) ETH-Greenland expedition in summer 1991 (Ohmura et al., 1992). (i) Cabauw ...

Еще в разделе: (Показать все результаты (>8) - geophys.srcc.msu.ru/ )

• http://geophys.srcc.msu.ru/library/parcfd2003.pdf

... В.Е.Фортов, В.К.Грязнов, А.А.Леонтьев, В.Б.Минцев, В.Е.Беспалов, Ю.В.Иванов IV Всесоюзная конференция по физике низкотемпературной плазмы. ... Experimental study of a dense xenon plasma under high pressures. V.B.Mintsev Proc. of 2-d Int.workshop on non-ideal plasmas. ... Yu.B. Zaporogets, V.B.Mintsev, V.E.Fortov In book: Current topics in shock waves, New York, 1989, p.549-555. ... Strongly coupled plasma physics at megabar pressures V.E.Fortov, V.B.Mintsev In book: High Pressure phenomena. ...

Еще в разделе: (Показать все результаты (>8) - www.test.physchem.msu.ru/ )

... Research . ... 1972 – current: Moscow State University . ... In 1989 she took her doctor's degree in linguistics (kandidat filologicheskikh nauk) at Lomonosov Moscow State University for the thesis "Computer data bases of the Selkup language: creation and use in linguistic research (Mashinnyi fond selkupskogo yazyka: sozdaniye i ispol’zovaniye v konkretnykh lingvisticheskikh issledovaniyakh)”. ... Documentation of and research into endangered languages presupposes linguistic fieldwork . ...

Еще в разделе: (Показать все результаты (>15) - lcl.srcc.msu.ru/ )

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>8) - mouse.genebee.msu.ru/ )

• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex1/valv_archaea_fasta.txt

... Sov.Phys.-Plasma Phys.) 1978.V.4. ... Timofeev I.B., Bychkov V.L. Influence of ionizing processes on the lifetime of plasma ball in air. ... Bychkov V.L. Database on ball Lightning for PC. ... Bychkov V.L., Bychkov A.V., Stadnik S.A. Polymer Fire Balls in Discharge Plasma. ... Emelin S.E., Bychkov V.L., Astafiev A.M., Kovshik A.P., Pirozerski A.L. Role of discharge products throttling for generation of ball lightning with a condensed core from a high pressure vapor - gas phase Proc. 11-th Intern. ...

Еще в разделе: (Показать все результаты (>8) - physelec.phys.msu.ru/ )

• Список основных публикаций группы "Сканирующая электронная микроскопия"

Fulbright Summer School in the Humanities is held annually since 1997 under the aegis of the Fulbright Program in Russia, Moscow University and the Russian Association for American Studies in partnership with a number of American universities. ... The goals of the Summer School are . ... It also helps develop the necessary bi-lingual and bi-cultural communication skills among Russian and American students/scholars providing impetus for innovative research and relevant publications. €а . ...

Еще в разделе: (Показать все результаты (>9) - discours.philol.msu.ru/ )

• Summer School Archives
• Department

A full system of equilibrium differential equations for the finite number of suspension lines (n = 28) of square parachute is derived. ... One can determine the shapes of inflated canopy radial cross-sections, stress distribution of radial ribbons on the canopy surface and fabric stress between them, drag coefficients for various line lengths and air-permeability by means of computer simulation. ... Initially, this problem was solved assuming D p = const over total canopy of square parachute. ...

Еще в разделе: (Показать все результаты (>8) - margaret.imec.msu.ru/ )

• Large-Scale Load Stabilization
• A Little History
• teachers

... Understanding Attitudes and Predicting Social Behaviour. ... Bandstatter, H. (1993). Should Economic Psychology care about personality structure? Journal of Economic Psychology, 14(3), 473-494. Berthoud, R., and Kempson, E. (1990). ... Journal of Economic Psychology, 11(4), 545-556. ... British Journal of Social Psychology, 28, 159-171. ... Journal of Economic Psychology, 14(2), 337-376. ... The Economic Mind: The social psychology of economic behaviour. ... The Social Psychology of Aging. ...

Еще в разделе: (Показать все результаты (>16) - psyberlink.flogiston.ru/ )

International Symposium Biological Motility: New facts and hypotheses ================================================= Pushchino , Moscow region, Russia May 12-14, 2014 Chairman of Organizing Committee Prof. Zoya Podlubnaya Institute of Theoretical and Phone (4967)739269 Experimental Biophysics RAS Fax (4967)330553 Pushchino , Moscow region E-mail: motility2014@iteb.ru 142290, Russia Preliminary information Dear colleagues, The ... Deadline for sending abstracts is 1 of March 2014. ...

Еще в разделе: (Показать все результаты (>2) - cytol.bio.msu.ru/ )

О КАФЕДРЕ . ... М., 2002 г., с. 100. ... М., 2002 г., с. 100-101. ... Материалы шестой международной конференции "К созданию общей теории нефтегазоносности недр" кн.2, Москва, ГЕОС, 2002, с. 154-156. ... Proceedings of the international conferens "The Earth's thermal field and related research methods". Moscow, 2002, p. 27-29. ... Petrunin G.I., Popov V.G. Hyper thermal analysis of features of the gear phonon heat transfer in solid solutions of plagioclase. ... Moscow, 2002, p. 196-199. ...

Еще в разделе: (Показать все результаты (>2) - geo.phys.msu.ru/ )

... 5-я летняя школа по геометрическим методам математической физики, 23-26 июня 2015 г. new . ... Лаборатория "Геометрические методы математической физики" была создана в декабре 2010г. после объявления победителей гранта Правительства Российской Федерации для государственной поддержки научных исследований, проводимых под руководством ведущих ученых в российских образовательных учреждениях высшего профессионального образования. ... на семинаре "Геометрия и группы" состоится доклад: . ...

Еще в разделе: (Показать все результаты (>2) - dubrovinlab.msu.ru/ )

... Родился 28 августа 1965 г. Окончил физический факультет Московского Государственного университета им. М.В. Ломоносова в 1988 г. Специальность по образованию - физик. 1995 г. - защитил кандидатскую диссертацию. ... E-mail: larichev@optics.ru . ... Goncharov A.S., Iroshnikov N.G., Larichev A.V., Nikolaev I.P., The impact of speckle on the measurement of eye aberrations, 2014, Journal of Modern Optics, ? ... PDF . ... Goncharov A.S., Larichev A.V., Iroshnikov N.G., Ivanov V.Yu., ...

Еще в разделе: (Показать все результаты (>5) - medphys.phys.msu.ru/ )

... Siberian Lang . Minority languages of Siberia as our cultural heritage . ... The project ?Development of the web-site ?Minority languages of Siberia as our cultural heritage? (on the material of the languages of the basin Middle Yenisei and the Middle and the Upper Taz)? was realized at the Laboratory for Computational Lexicography, Research Computing Centre, Lomonosov Moscow State University, with financial support from Russian Foundation for the Humanities, grant 12-04-12049.љ ...

298. http://www.kosmofizika.ru/buri/vesel2.pdf

299. 5-th All-Russian Conference - Timetable

300. Ученые детям