Thunderstorms and Elementary Particle Acceleration . ... Conference . The first announcement . ... The Thunderstorms and Elementary Particle Acceleration (TEPA-2012) conference is the second one devoted to the studies of the extreme atmospheric effects connected with amplification of electric fields in the lower atmosphere. ... TEPA-2012 conference will be held from July 9 till July 11, 2012, just after the 23rd European Cosmic Ray Symposium also organized by MSU ( http://ecrs2012.sinp.msu.ru ) . ...

Еще в разделе: (Показать все результаты (>2) - tepa2012.sinp.msu.ru/ )

Lomonosov Moscow State University Biological faculty Botanical garden (Russia) (http://botsad.msu.ru/eng_news.htm) Botanical garden of the Komarov Botanical institute (Russia) Russian Iris Society Botanical garden of Taurida National Vernadsky University (Ukraine) The second information message Dear colleagues! ... Educational and enlightening activities based on collections of genus Iris L. The program of the Symposium will consist of plenary and sectional sessions as well as poster presentations. ...

Еще в разделе: (Показать все результаты (>11) - botsad.msu.ru/ )

• http://www.botsad.msu.ru/docs/eng_iris1.doc
• Botanical garden of Lomonosov Moscow State University

... Разработка и внедрение образовательных программ повышения квалификации специалистов в области инновационной деятельности . ... Master Degree in Geology . Master Degree in Management . Master Degree in Chemistry . ... 06/04/2016 . ... 29 марта 2016 г. День открытых дверей Высшей школы инновационного бизнеса . ... 27 марта 2016 года Московский государственный университет имени М.В.Ломоносова приглашает на весенний ДЕНЬ ОТКРЫТЫХ ДВЕРЕЙ . ... New technologies in gas chemistry . ...

Еще в разделе: (Показать все результаты (>4) - www.hsib.msu.ru/ )

• Master Degree in Management | Высшая школа инновационного бизнеса МГУ

JOURNAL OF APPLIED PHYSICS VOLUME 86, NUMBER 6 15 SEPTEMBER 1999 The rate of radiative recombination in the nitride semiconductors and alloys Alexey Dmitrieva) and Alexander Oruzheinikov Department of Low Temperature Physics, Faculty of Physics, M. V. Lomonosov Moscow State University, Moscow, 119899, Russia Received 7 January 1999; accepted for publication 27 May 1999 The radiative recombination rates of free carriers and lifetimes of ... Phys., Vol. ... We will see in the Sec. ...

Еще в разделе: (Показать все результаты (>16) - lizard.phys.msu.su/ )

• http://lizard.phys.msu.su/home/science/rec-GaN.ps.gz
• http://lizard.phys.msu.su/home/science/jap-06.pdf

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>5) - mouse.genebee.msu.ru/ )

• Nhunt: program for nucleic acid sequence similarity search
• About

... взаимодействие языка и культуры в контексте сравнительно-исторических исследований; . ... The Philology Faculty of Moscow State Lomonosov University will hold the VIII International Scientific Conference on Comparative-Historical Linguistics 'Modern methods of comparative historical research', from 25 to 27 September 2013, which is traditionally organized by the Department of General and Comparative-historical linguistics. ... History of Comparative Linguistics. ...

Еще в разделе: (Показать все результаты (>49) - genhis.philol.msu.ru/ )

• Марчук Юрий Николаевич, профессор, доктор филологических наук

... N. Konev, D. N. Matorin, R. Hapter, and A. B. Rubin Moscow State University, Moscow, Russia Received February 12, 1998; in final form, November 18, 1998 Abstract--Vertical profiles of phytoplankton primary production (PP), chlorophyll a, and fluorescence measured near the surface in the central Baltic Sea in September 1995 featured similar variations related to the diurnal dynamics of solar radiation. ... Vertical profiles of the measured and calculated values of primary production. ...

Еще в разделе: (Показать все результаты (>37) - library.biophys.msu.ru/ )

• http://library.biophys.msu.ru/PDF/3334.pdf
• http://library.biophys.msu.ru/matorin/3414.pdf
• http://library.biophys.msu.ru/matorin/3393.pdf

... Petrakov Director of the Market Problems Institute, Russian Academy of Sciences Secretary: Professor Elena N. Veduta, School of Public Administration , Lomonosov Moscow State University Alexandrov, Dmitry ( Russia , Moscow ) ­ General Theory of Economic Growth and Models of National Economic Development Antonova, Victoria ( Russia , Moscow ) ­ Democratization of Economic Life as the Basis of Sustainable ...

Еще в разделе: (Показать все результаты (>64) - www.spa.msu.ru/ )

• http://www.spa.msu.ru/uploads/files/konferenzii/_program_conference_2013_eng.pdf
• http://www.spa.msu.ru/uploads/files/h8dissertazionnii_sovet_d_501.001.27h8brh923.00.02__polititcheskie_instituti_prozessi_i_tehnologiih9/vasilieva_dissertaciya.pdf

... President George W. Bush Department of Education Strategic Goals: Goal One: Create a Culture of Achievement Create a culture of achievement by effectively implementing the president's plan, No Child Left Behind, and by basing all federal education programs on its principles: accountability, flexibility, expanded parental options, and doing what works. ... Goal Six: Establish Management Excellence Create a culture of accountability throughout the Department of Education. ... accountability | ... line...

Еще в разделе: (Показать все результаты (>2) - www.edst.msu.ru/ )

... Likert-type scale response anchors. ... Level of Acceptability . ... Neutral . ... Level of Appropriateness . ... Level of Importance . ... Level of Agreement . ... Somewhat disagree . ... Somewhat agree . ... Never true . ... Rarely true . ... Sometimes but infrequently true . ... Sometimes true . ... Usually true . ... Always true . ... Somewhat true of me . ... Somewhat true of what I believe . ... Priority: . ... Somewhat priority . ... Priority Level . ... satisfied . ... Somewhat satisfied . ...

Еще в разделе: (Показать все результаты (>2) - tukachev.flogiston.ru/ )

... The Department of Operations Research . April 9, 2016 . Welcome Traditional topics of the conference Important dates Abstracts Registration . ... dedicated to the outstanding Russian scientists . ... Moscow, April 10-14, 2007 Welcome . ... Dorodnicyn Computing Center of RAS, Computational Mathematics and Cybernetics Faculty of the M.V.Lomonosov Moscow State University and Russian Scientific Operations Research Society will organize the Vth Conference in April 2007 in Moscow. ...

Еще в разделе: (Показать все результаты (>12) - io.cs.msu.ru/ )

• Contacts - ORM 2007
• Abstracts - ORM 2007
• Accommodation - ORM 2007

SUNY-MSU Partnership . ... MSU | ... The State University of New York/Moscow State University partnership dates back to the mid-1970s and owes its existence to the vision of then MSU Rektor Rem Kokhlov and SUNY Chancellor Ernest L. Boyer. ... The first students were exchanged in 1977. ... A SUNY Center on Russia and the United States opened its doors in January 2000, and a sister MSU Center on the United States and Russia was set up in Moscow at MSU?s newly built Science Park. ... suny-msu . ...

293. depozitariy | Living systems depository "Noah's Ark"

294. K-corrections calculator (version 2010)

295. Nove in M31 2, 1998

296. http://fmp.msu.ru/index.php?option=com_k2&view=itemlist&task=calendar&month=9&year=999&catid=35&Itemid=1165

297. EDAS2 - Alternative Splicing DataBase.

298. Адрес

299. Литература по анатомии ЦНС, физиологии ВНД, психопатологии. | А.А. Сакбаев

300. http://law.msu.ru/bitcache/bc6ca81fd934d7083472270ea392667daf49eebb?vid=30191&disposition=attachment&op=download