Координатор семинара : академик РАН и Academia Europaea Алексей Ремович Хохлов . ... Заседания семинара проводятся в Конференц-зале Института элементоорганических соединений им. А.Н. Несмеянова РАН ( ИНЭОС РАН , г. Москва, ул. Вавилова, 28). ... Скачать объявление о семинаре . ... Б.М. Графов (Интститут физической химии и электрохимии имени А.Н. Фрумкина РАН, Москва) . ... После доклада предполагается обсуждение целесообразности организации Общемосковского семинара по электрохимии. ...
... Keywords: boundary-layer depth, stable stratification, Ekman layer. ... Experimental data (23) Data sets used in this paper for empirical validation of the proposed SBL depth formulation are taken from three measurement sites ( Figure 1), namely, (i) Cabauw measurement station (Nieuwstadt, 1984; Van Ulden and Wieringa, 1996), (ii) BASIS (Baltic Air-Sea-Ice Study) field experiment (Launiainen, 1999), and (iii) ETH-Greenland expedition in summer 1991 (Ohmura et al., 1992). (i) Cabauw ...
... О кафедре . English . ... Department for Jewish Studies of Lomonosov Moscow State University . ... The Department for Jewish Studies (DJS) was established in 1998. ... The students take courses offered by the School (the Institute of Asian and African Studies), as well as courses offered by the Jewish Studies Department. ... The Department regularly accepts university teachers of Jewish and Israeli Studies from Russia and the FSU in order to upgrade their professional level. ...
... Ряд крупных исследовательских центров в мире занимается исследованиями в области ПЛИС и вычислительных систем, строящихся на их основе. В данном разделе размещается информация о работе основных исследовательских центров по тематике ПЛИС. ... В университете Торонто работает одна из наиболее активных исследовательских групп в области FPGA. ... FPGA High Performance Computing Alliance. Разработанные программнные и аппаратные средства использованы при построении FPGA-суперкомпьютера Maxwell. ...
яЛП . id #345 . New Directions for Higher Education [not defined] . Common information . Periodicy: . [no information] . Impact-Factor: . [no information] . ISSN: . 1536-0741 . In print: . since 1997-01-01 till today . Language: . en . Price: . subscription - $160,single article - $1 . Classifier: . [no at all] . Published by . (4) . Wiley Interscience - roboUpdate . No homepage defined . No open resources defined . Close . Complain . Edit
... The philosophical consequences of synergetics, the interdisciplinary theory of evolution and self-organization of complex systems, are being drawn in the paper. ... Key words: complex systems, evolution, nonlinearity, pre-determination, self-organization, soft management, structure-attractors, synergetics 1. ... The spectra of possible, `allowed' structures correspond to sets of the eigenfunctions of the nonlinear equations describing the evolutionary processes in the complex system. ...
[
Текст
]
Ссылки http://www.students.chemport.ru/materials/Philosophy/orph.pdf -- 61.0 Кб -- 15.01.2009 Похожие документы
Please enter the lightcurve file name and period search parameters: . Lightcurve file: . ... Apply the Heliocentric correction and convert all dates to Terrestrial Time (TT)? ... Phase range for plots: -0.5 to 1.0 0.0 to 2.0 0.0 to 1.0 . ... Also, the Heliocentric correction cannot be applied to such lightcurves. ... Two period search methods are currently implemented. ... This period search service is also available at the mirror sites: Mirror 1 , Mirror 2 , Mirror 3 , Mirror 4 . ...
... SPAND- `TO LIBATE': ONE MORE CASE OF LUVIAN INFLUENCE ON NEW HITTITE It is well-known that the syllabic cuneiform writing is not fit for the unambiguous representation of word-initial consonant clusters.1 The phonological sequence /C1C2-/ can only be represented as either C1V-C2V- or VC1-C2V- in syllabic orthography, and in neither of the two cases can one be a priori sure whether the vocalic component of the first syllabic sign is phonetically real. ... On initial *sm- in Hittite, cf. ...
[
Текст
]
Ссылки http://www.imk.msu.ru/Structure/Linguistics/yakubovich/download/sippanti.pdf -- 305.7 Кб -- 30.04.2010
[
Текст
]
Ссылки http://imk.msu.ru/Structure/Linguistics/yakubovich/download/sippanti.pdf -- 305.7 Кб -- 30.04.2010 Похожие документы
... The students of the Faculty of Geography study territorial distribution and spatial development patterns of various natural phenomena as well as social and economic objects. ... The academic program includes courses with lectures, seminars, laboratory and field training in natural sciences and humanities which form 4 blocks: . ... In addition to the field stations of the Faculty, the students have an opportunity to have their field training in scientific institutions and different companies. ...
... First, dissipative particle dynamics (DPD) simulations of a flow past such surfaces have been performed to validate an expression [E. S. Asmolov and O. I. Vinogradova, J. Fluid Mech. 706, 108 (2012)] that relates the eigenvalues of the effective slip-length tensor for one-dimensional textures. ... We use local slip profiles with 1 = 2 . ... The data show that the triangular profile gives a larger, and the rectangular one a smaller effective slip than that resulting from the trapezoidal local slip. ...
... A new mechanism governing the dynamics of territory changing between groups of people such as countries is proposed based on trading with approval of both sides under particular voting rule (veto rule, majority rule, etc.) ... A state equation is obtained based on particular personal utility function. ... The countries which have approximately the same marginal 4 utility of the territory at the border would fight rather than trade as a result of equilibrium in the corresponding game. ...
... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...
[
Текст
]
Ссылки http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/poster_mccmb_2011.pdf -- 225.5 Кб -- 21.07.2011 Похожие документы
... История кафедры . ... S. Auclair, R. Uzbekov, S. Elis, L. Sanchez, I. Kireev, L. Lardic, R. Dalbies-Tran, and S. Uzbekova. ... I. Vorobjev, K. Buchholz, P. Prabhat, K. Ketman, E. Egan, M. Marti, M. Duraisingh, and N. Barteneva. ... Belmont AS, Hu Y, Sinclair PB, Wu W, Bian Q, Kireev I. Insights into Interphase Large-Scale Chromatin Structure from Analysis of Engineered Chromosome Regions. ... Цитология, (2010), т. 52, ? ... Hu Y., Kireev I., Plutz M., Ashourian N., Belmont AS. ... 2008), 5(4):311...
The Laboratory of the Historical Information Science . ... The historical information science laboratory was founded within the structure of the source studies department on 8 December 1995 for the purpose of fulfilling the decision of the academic council of the History Faculty of 4 October 1991 about the transformation of a group for the application of mathematic methods and mainframes in historical research in the laboratory of historical information sciences. ... Senior laboratory assistant (2) . ...
... О факультете . ... Master In Ecology . ... Master (MSc) . ... A Master will be able to successfully deal with conceptual issues and practical problems related to various subflields of ecology and environmental science. ... Enables the students to develop biopolicies to deal with ecological problems caused by environmental pollution, the disruption of the ecological matrix of an area, and biodiversity-endangering factors. ... Lectures . ... Д 501.001.20 - все защиты . ... Биологический факультет МГУ ...
trendence Graduate Barometer Europe 2011 About the survey About trendence trendence Graduate Barometer Europe is an annual online student survey which allows students to express their opinion on topics re lated to career and education. ... Ulrike Heyne Project Manager trendence Graduate Barometer Europe 2011 About the survey Facts and benefits How does it work? ... If your students take part in the trendence Graduate Barometer, they will receive an exclusive Student Report. ...
[
Текст
]
Ссылки http://studsov.math.msu.su/Sites/studsovet/Uploads/trendence_GBE_2011_-_About_the_survey.docs1.pdf -- 209.6 Кб -- 20.10.2012 Похожие документы