... Currently there are 27 faculties - of Mechanics and Mathematics, Computational Mathematics and Cybernetics, Physics, Chemistry, Geology, Biology ... Sociology, Institute of Asian and African Studies, Public Administration and Social Studies, Materials Sciences, Pedagogy, Arts, International Relations, Bioengineering and Bioinformatics, Continuing Education , Center for International Education The total number of students including post-graduates is currently 40,000. ...
International Symposium Biological Motility: New facts and hypotheses ================================================= Pushchino , Moscow region, Russia May 12-14, 2014 Chairman of Organizing Committee Prof. Zoya Podlubnaya Institute of Theoretical and Phone (4967)739269 Experimental Biophysics RAS Fax (4967)330553 Pushchino , Moscow region E-mail: motility2014@iteb.ru 142290, Russia Preliminary information Dear colleagues, The ... Deadline for sending abstracts is 1 of March 2014. ...
[
Текст
]
Ссылки http://cytol.bio.msu.ru/docs/Information%20letter%202014-1.doc -- 215.0 Кб -- 19.03.2014 Похожие документы
... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...
[
Текст
]
Ссылки http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/poster_mccmb_2011.pdf -- 225.5 Кб -- 21.07.2011 Похожие документы
русский english MSU of Lomonosov Higher School . of Policy in Culture . and Administration in Humanities (faculty) . ... Lecturers . Faculty in the people . ... The leading representatives of Russian sport and culture are engaged in teaching at the faculty: . ... Mark A. Gurvich Chairman of Moscow Board of Theatres, . ... Higher School of Policy in Culture and Administration in Humanities (faculty Lomonosov Moscow State University) 2016 . ...
... Think of a career with McKinsey & Company. Better yet - come over for an informational session with our senior partners on May 15, at 7 PM , Baltchug hotel . You will have a chance to find out all about McKinsey & Company - who we are, what we do, what we look for in people, how we select new associates and what you can achieve as a McKinsey consultant. You will have an opportunity to talk to McKinsey senior partners - first during an official Q&A session and then at cocktails. ...
... Программы обучения . ... Пропустить категории курсов . ... Пропустить новости . ... от Администратор ЦДО Ф/Ф МГУ - Понедельник 4 Август 2014, 09:53 . 04 августа 2014 года в Интеллектуальном центре ? ... Российские ВУЗы все чаще переходят на дистанционное обучение . ... ДИСТАНЦИОННЫЕ ПОДГОТОВИТЕЛЬНЫЕ КУРСЫ ФИЗИЧЕСКОГО ФАКУЛЬТЕТА МГУ ПО ФИЗИКЕ И МАТЕМАТИКЕ Пропустить Страницы ЦДО в социальных сетях . ... Центр дистанционного образвания физического факультета МГУ им. М.В. Ломоносова 2007-2012 . ...
Alexander S. Antonov . ... M.V.Lomonossov Moscow State University . ... June 4, 1999, Moscow State University . ... 1994-2000: programmer, Laboratory of Parallel Information Technologies, Research Computer Center, Moscow State University . ... A.S. Antonov, A.M. Teplov. ... Antonov A.S., Voevodin Vl.V., Sobolev S.I., Filamophitskiy M.P. Internet-Auditorium of Lomonosov Moscow State University // Abstracts of the All-Russian scientific conference "Scientific Services Internet" (Novorossiysk, 2000). ...
. Department of Physics, Lomonosov Moscow State University . Laboratory "Сryoelectronics" . You are here: љ . Home . Research groups . Home . Publications . Staff . Research groups . Devices based on LTS and HTS . Superconducting electronics . Probe microscopy . Nanoelectronics . Molecular single-electronics . Feedback Back to Top . 2016 Laboratory "Сryoelectronics"
Заведующий кафедрой Head of the Chair . ... История кафедры . ... В 1966 г. для расширения ведущихся на кафедре научных работ в НИИ Ядерной физики МГУ был создан отдел физики плазмы (ОФП), в 1989 году переименованный в отдел микроэлектроники (ОМЭ). ... Сегодня по различным научным направлениям, ведущимся по специальностям, преподаваемым на кафедре атомной физики, физики плазмы и микроэлектроники, работает около 100 научных сотрудников, среди которых 12 докторов наук и около 50 кандидатов наук. ...
Вы посетили: arzhantsev_publications . ... История кафедры . ... I.V.Arzhantsev, U.Derenthal, J.Hausen, and A.Laface. ... Journal of the London Mathematical Society 89 (2014), no. ... И.В.Аржанцев, М.Г.Зайденберг и К.Г.Куюмжиян. ... Математический Сборник 203 (2012), вып. ... Finite-dimensional subalgebras in polynomial Lie algebras of rank one. ... Однозначность сложения в полупростых алгебрах Ли. ... staff/arzhantsev_publications.txt Последние изменения: 12.01.2016 23:11 От arjantse | ...
... Для того чтобы отправить детей школьного возраста (от 7 до 15 лет) в летний оздоровительный лагерь МГУ по льготным путевкам надо срочно представить в отдел социальных программ МГУ заявление, оформленное в профкоме вашего подразделения. Социальная программа МГУ для детей Детский оздоровительный лагерь «УНИВЕРСИТЕТСКИЙ» находится недалеко от Звенигорода. (62 км. по Минскому шоссе). ... Все удобства в номерах). ( ориентировочная стоимость) |Заезды |30.05 - 19.06 |Полная стоимость детской | ...
MOSCOW STATE UNIVERSITY The Scientific Society of students of the Law Faculty January 25, 2014 1- The flyer of the Unit `Jurisprudence' of International scientific conference "Lomonosov - 2014" 1. ... The organizers of the Unit are the law faculty of Moscow State University and the Scientific Society of students of the law faculty. ... Administrative law 2. ... The Organizing Committee: Presiding Officer Kozlova Natalya Vladimirovna (Deputy Dean of Law Faculty on study, Doctor in Law, Professor). ...
[
Текст
]
Ссылки http://law.msu.ru/bitcache/bc6ca81fd934d7083472270ea392667daf49eebb?vid=30191&disposition=attachment&op=download -- 260.2 Кб -- 28.02.2014 Похожие документы
... N.5, pp.592-597 (scanned PDF file, English version) . ... A.V.Shanin, Embedding formula for electromagnetic diffraction problem // Zapiski seminarov POMI, V.324, pp.247-261 (2001), in Russian, (PDF file, Russian version) (PDF file, English version) . ... PDF file) . ... Shanin A.V., Coordinate equations for the Laplace-Beltrami problem on a sphere with a cut // QJMAM, 2005 (58) 2, 1-20 The preprint versions of two previous papers have been sent to URSI contest: Paper 1, PDF file , Paper 2, PDF file ...
... Н айти друзей по учебе, договориться о встрече группы или курса, рассказать о себе и своей работе, разместить информацию о своей организации, поздравить соседа по университетской парте с днем рождения, обсудить общие проблемы - все это можно сделать в Клубе выпускников. ... З десь Вы можете найти информацию о любом зарегистрированном выпускнике МГУ, а также обновить информацию о себе или о тех, чей пароль Вы знаете. ... Экономический, 1999 . Биологический, 1999 . Биологический, 1986 . ...
Data are provided with the intent that they are readily available for personal and public non-commercial use and may be reproduced, in part or in whole and by any means, without charge or further permission from IWSG. However, proper reference to contributors of original data to the database must be provided in all cases, and due diligence should be exercised in ensuring the accuracy of the materials reproduced . ... Bird species report. In : ARCTIC BIRDS breeding conditions survey . ...
... 28 марта 2016 года Палата патентных поверенных совместно с МГУ имени М.В. Ломоносова и ?Иннопрактикой? провели круглый стол на тему ?Включение изобретения в проектную документацию как факт его использования?. ... Компания ?Иннопрактика?, объединяющая Центр национального интеллектуального резерва МГУ и Фонд ?Национальное интеллектуальное развитие?, 18 декабря подведет итоги конкурсного отбора прорывных идей ?Эврика! ... 2012 Центр национального интеллектуального резерва МГУ имени М.В. Ломоносова . ...
... 11:00-11:30 Break 11:30-12:00 Lecture 3 Prof . Heinz Oberhammer , Institute of Physical and Theoretical Chemistry , University of Tubingen, Germany Structures and Conformations of Disilacyclohexanes 12:00-12:30 Lecture 4 Prof . Ingvar Arnason , University of Iceland, Iceland Energetics and Potentional Energy Surfaces of Disilacyclohexanes 12:30-13:00 Lecture 5 Prof . Igor Godunov, Chemistry Department , MSU , ...
... 2011 . 2012 ., ... 1) 97% , () 100 96%, 92%; 2) 72%, 85%, , , , 70%. ... 93% 2010 ., ... 100 % () , , 2010 / 2011 , 13 ZYRYANOV V., KOTLOBOVSKY I., SINYAKOV A. UNIVERSITIES PREPAREDNESS TO IMPLEMENT THE FEDER AL STATE : EDUCATIONAL STANDARDS: ORGANI ZATIONAL ASPECT The article continues to present the results of monitoring the implementing effectiveness of the federal state educational standards ( FSES ) of higher education institutions conducted by the Association of Classical ...
[
Текст
]
Ссылки http://www.umo.msu.ru/docs/projects/monitoring/gotov_k_real_fgos_12_12.pdf -- 343.1 Кб -- 01.04.2013 Похожие документы
... International Olympiad БЂњNanotechnologies БЂ“ Breakthrough to the Future!БЂќ . ... The Olympiad allows the participation of primary, secondary and high school students, BSc, MSc, PhD students, young scientists, teachers and tutors, or enthusiasts of materials sciences and nanotechnologies . ... The site www.nanometer.ru is the official portal of the International Olympiad on nanotechnologies БЂњNanotechnologies БЂ“ Breakthrough to the Future!БЂќ . ...