Statistics in Morse theory of smo oth functions Vladimir I. Arnold Steklov Mathematical Institute, Moscow, Russia e-mail: arnold@mi.ras.ru There are exactly 17746 topologically distinct Morse functions with 4 saddles on the two dimensional sphere. This result basing on combinatorics of random graphs was obtained only two years ago within an investigation of Hilbert's 16th problem on topological classification of polynomials in real algebraic geometry. ...
[
Текст
]
Ссылки http://pont2008.cs.msu.ru/files/en/abstracts/Arnold.pdf -- 26.1 Кб -- 07.01.2008
[
Текст
]
Ссылки http://pont2008.cmc.msu.ru/files/en/abstracts/Arnold.pdf -- 26.1 Кб -- 07.01.2008 Похожие документы
A project of laser electron X-ray generator for scientific applications I.A. Artyukov, E.G. Bessonov, A.V. Vinogradov, M.V. Gorbunkov, Yu.Ya. ... The possibility of the creation and the application prospects of the laser-electron X-ray generator based on Thompson scattering of laser radiation on a bunch of relativistic electrons are considered. ... It allows viewing collision of electrons with laser photons as the classical Thomson scattering. ... A project of X-ray laser-electron generator [7]. ...
... Journal of Algebra 323 (2010) 22702289 Contents lists available at ScienceDirect Journal of Algebra www.elsevier.com/locate/jalgebra Automorphisms of Chevalley groups of type F 4 over local rings with 1/2 E.I. Bunina M.V. Lomonosov Moscow State University, Leninskie Gory, Main Building of MSU, ... Department of Higher Algebra, Moscow 119992, Russia article info abstract In the given paper we prove that every automorphism of a Chevalley ... Ring automorphisms. ... Denote matrix units by E ij...
[
Текст
]
Ссылки http://halgebra.math.msu.su/wiki/lib/exe/fetch.php/staff:yjabr12829.pdf -- 449.2 Кб -- 13.02.2013 Похожие документы
... 8 February , 2014 SAI seminar (Ryde et al 2010) 5 Thermal emission from GRB jet progenitor observer photon jet Photosphere (=1) · · · · Photons are not produced at the photosphere We have to calculate radiative transfer We need to know where the photons are produced We construct the expression for effective optical depth in relativistic flow considering random walk process in relativistic flow SAI seminar 6 8 ... 8 February, 2014 SAI seminar 28 ...
[
Текст
]
Ссылки http://master.sai.msu.ru/media/presentations/2014/20140208_Shibata.pdf -- 1131.7 Кб -- 07.02.2014 Похожие документы
Serge Moscovici . Social Representations mailing list 1 postings, 28 Apr - 27 May 1997 . ... Deriabin wonders why social constructionism and social representations do not get close to one another. ... I cannot see where and how the theory of social representations has been rewritten to fit the cognitive paradigm. ... What is important for me now, at this point of my thinking, is the following: without a theory of social representations, we cannot understand social construction. ...
... О профессорах кафедры . ... Квантовая теория . ... Выполнение этих курсовых позволит студенту стать соавтором научных работ, или как минимум приобрести опыт работы с актуальными проблемами квантовой теории и физики фундаментальных взаимодействий, а также с современными вычислительными технологиями, без которых невозможно никакое содержательное исследование в этой области физики. ... Научный консультант - профессор А.В.Киселев, ГНЦ ИФВЭ . ... Научный консультант - с.н.с. Р.А.Рютин, CERN и ГНЦ ИФВЭ . ...
... Ядро МАТЛАБ содержит более тысячи функций. ... Кадр из анимационной сцены [pic] Исходный код S- функции , написанной на языке C++ с использованием библиотеки OpenGL для отображения анимационной картинки перемещения маятника на движущейся ... _GENERATE_TLC 1 #define SOURCEFILES #define PANELINDEX 6 #define SFUNWIZ_REVISION 2.0 #include simstruc.h static double x1 = 0, x2 = 0, x1_ = 0, x2_ = 0, X = 0; static double l1,l2; static int glInited = 0; static HWND hGlWindow = NULL ; static ...
[
Текст
]
Ссылки http://ndsipu.cmc.msu.ru/files/Kraev/MATLAB_FOR_STUDENTS.DOC -- 475.0 Кб -- 25.02.2008 Похожие документы
... О кафедре . ... Сотрудники . ... Соколов Дмитрий Дмитриевич, родился в 1949 г., поступил на Физфак МГУ в 1966 г., с 1972 г. - на кафедре математики, сначала аспирант, а потом, постепенно, стал профессором, доктором физ.-мат. наук. ... Magnetic fields as a unique tracer of shearing gas flow in a barred galaxy", Beck R., Ehle M., Shoutenkov V., Shukurov A., Sokoloff D., Nature, 397, (1999), 324. ... Семинар кафедры . ... Кафедра математики физического факультета МГУ им. М.В. Ломоносова . ...
О кафедре . ... Главная -> Люди -> Сотрудники -> Смирнов Алексей Игоревич . ... 5 курс . ... СМИРНОВ Алексей Игоревич родился 3 мая 1976 года в Москве. ... Работает на кафедре оптимального управления факультета ВМиК МГУ с 2001г. в должности aссистента. ... Ведет семинарские занятия по высшей математике (геологический факультет), оптимальному управлению, выпуклому анализу, математическому практикуму на факультете ВМиК. ... 2002 2016 Кафедра Оптимального управления факультета ВМиК МГУ . ...
Mechmath admission for internetional students . Specialist degree . ... Master degree . ... Master variants . ... About Faculty . ... Mathematics and Mechanics Faculty was created 1 May 1933 with a recovery of the faculty system inљ Lomonosov MSU . ... The faculty prepares high level experts of wide areas of Mathematics, Mechanics and Applying Mathematics , possessing theoretical knowledge and a technique of scientific experiment . ... 2016 Mechmath admission for internetional students ...
Сайт кафедры магнетизма Московского Университета . ... о кафедре . сотрудники . ... Радковская Анна Александровна . ... О.А. Kotelnikova, N.S. Perov, A.A. Radkovskaya, E. E. Shalygina, Faraday effect in ferrites in UHF range , Series of the Special Practicum of the Department of Magnetism, Faculty of Physics Library (Moscow University Press, Moscow, 2004). ... N.S. Perov, A.V. Bozhkov, A.A. Radkovskaya, An electro-chemical magnetic field sensor , Sensors and Actuators A Phys. 81, 351-354 (2000). ...
... B; b) be a map. ... The definition of shape fibration uses the approximate homotopy lifting property (AHLP) applied to ANRresolutions of maps. ... E (in proM) is an ANRresolution of E if and only if (E; q) = lim /\Gamma E and the following condition holds: for each i and any neighborhood U of q i (E) in E i there exists j ? ... A shape fibration p : E ! ... B between compact metric spaces is a 0dimensional shape fibration if and only if there exists an ANRresolution p = fp i g : E \Lambda ...
[
Текст
]
Ссылки http://num-anal.srcc.msu.su/list_wrk/ps1/ch4st1.ps -- 129.7 Кб -- 17.12.2002
[
Текст
]
Ссылки http://num-anal.srcc.msu.ru/list_wrk/ps1/ch4st1.ps -- 129.7 Кб -- 17.12.2002 Похожие документы
WRF . ... NCEP/NCAR, . ... WRF (Weather Research and Forecasting Model), , ' -35' (-35) ' -36' (-36). ... 11.12.2007 . ... 100 % . ... 400 . ... Fels S.B., Schwarzkopf M.D. The simplified exchange approximation: a new method for radiative transfer calculations // Journal of the Atmospheric sciences. ... Vol. ... Janjic Z.I. The surface layer in the NCEP Eta model. ... Janjic Z.I. Nonsingular Implementation of the Mellor-Yamada Level 2.5 Scheme in the NCEP Meso model // NCEP Office Note. ...
[
Текст
]
Ссылки http://atm563.phys.msu.ru/rus/gidromet_public_html/trudy/thmc3440111.pdf -- 1474.5 Кб -- 14.03.2011 Похожие документы
... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...
[
Текст
]
Ссылки http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/poster_mccmb_2011.pdf -- 225.5 Кб -- 21.07.2011 Похожие документы
... Stanley Milgram SIX DEGREES OF SEPARATION OR SMALL WORLD PHENOMENON 1998, Small world networks Steven Strogatz Duncan Watts Laszlo Barabasi and Reka Albert 1999 In 1999 American physicits Barabasi and Albert have shown that distribution of nodes by the number of links in tke most real networks is described by power law and they called such networks as scale-free networks Reprinted from Linked: The New Science of Networks by Albert-Laszlo ... Human disease network. ... disease , ). ...
[
Текст
]
Ссылки http://www.soc-phys.chem.msu.ru/rus/prev/zas-2015-12-01/presentation.pdf -- 1351.3 Кб -- 25.12.2015 Похожие документы
... Предыдущий пример . ... Cмена изображения с использованием эффекта "сдвиг" . Описание параметров метода switch_screen ( String screen_name, String change_type ) screen_name - имя виртуального экрана change_type = type type_param type - тип эффекта (shift, blind, random, fade) type_param - параметры эффекта данного типа сдвиг shift - time = step = xdir= ydir= old= center = time - время выполнения эффекта в миллисекундах, step - начальный шаг в пикселах xdir - =1 - выполняется ...
. Strict Standards : Non-static method JLoader::import() should not be called statically in /wcmc/ms/ms/libraries/joomla/import.php on line 29 . Strict Standards : Non-static method JLoader::register() should not be called statically in /wcmc/ms/ms/libraries/loader.php on line 71 . Strict Standards : Non-static method JLoader::import() should not be called statically in /wcmc/ms/ms/libraries/joomla/import.php on line 32 . Strict Standards : Non-static method JLoader::register() should not be called