... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...
[
Текст
]
Ссылки http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/poster_mccmb_2011.pdf -- 225.5 Кб -- 21.07.2011 Похожие документы
XXI ) : 23.00.02 - , - 2015 « ». ... 1992. 3. . ... 2000; . ... 5; Beck U. World Risk Society. ... Cambridge, 1990; Luhmann N. Risk: A Sociological Theory. ... Modern Political Analysis. ... Risk Management and construction. ... New York: McGraw-Hill, 2000; Charles R. Kennedy (1988), "Political Risk Management: A Portfolio Planning Model," Business Horizons, 31(6); Carlson, Sunne. ... Published by Routledge, 2009. 304 p.; Brink, Charlotte H. Measuring political risk: risks to foreign investment. ...
[
Текст
]
Ссылки http://www.spa.msu.ru/uploads/files/h8dissertazionnii_sovet_d_501.001.27h8brh923.00.02__polititcheskie_instituti_prozessi_i_tehnologiih9/avtoreferat_vasileva.pdf -- 616.2 Кб -- 26.03.2015 Похожие документы
This domain may be for sale - этот домен возможно продается . ... The gathered information about your visits to this and other websites are used by these third party companies in order to provide advertisements about goods and services of interest to you. ... If you would like more information about this practice and to know your choices about not having this information used by these companies, click here . ...
... Siberian Lang . Minority languages of Siberia as our cultural heritage . ... The project ?Development of the web-site ?Minority languages of Siberia as our cultural heritage? (on the material of the languages of the basin Middle Yenisei and the Middle and the Upper Taz)? was realized at the Laboratory for Computational Lexicography, Research Computing Centre, Lomonosov Moscow State University, with financial support from Russian Foundation for the Humanities, grant 12-04-12049.љ ...
... Oleinik V.P. The change of the course of time in a force field and imponderability. ... The general formula for the relative course of time between the points lying on the trajectory of motion of particle under the action of a force field in an inertial reference frame is derived. ... It is noted that the change in the course of time in a force field is in no way connected with the change in space-time metric and is a direct consequence of the causality principle of relativistic mechanics. 1. , , . ...
[
Текст
]
Ссылки http://temporology.bio.msu.ru/RREPORTS/oleinik_izmenenie.pdf -- 275.9 Кб -- 27.02.2014 Похожие документы
Contents Curricula, and Programs. Mathematical Analysis. (The Program of Mathematical Physics Department).............................................. Algebra and Analytical Geometry.(The program of (General "Mathematics" Department)................................ Computer and Programming. (The program of Algorithmic Languages Department).................................... The practical work on Computers.( Department of Algorithmic. Languages)............................................... Discrete
[
Текст
]
Ссылки http://mph.cs.msu.ru/mph/arh/blank/1999pro-en.doc -- 190.5 Кб -- 17.02.2011
[
Текст
]
Ссылки http://mph.cs.msu.su/mph/arh/blank/1999pro-en.doc -- 190.5 Кб -- 17.02.2011
[
Текст
]
Ссылки http://mph.cmc.msu.ru/mph/arh/blank/1999pro-en.doc -- 190.5 Кб -- 17.02.2011 Похожие документы
... Unit I. Geologic Hazards and Man Unit II. ... Amazing Earth. ... Трансформируйте словосочетания в предложения. 1. geologic processes going on for millions of years 2. any geologic process can become a geologic hazard 3. some geologic hazards having resulted in disaster 4. many geologic hazards have affected the activity of man 5. a lot of earthquakes resulting in landslides 6. some naturally occurring hazards 7. many disasters are caused by geologic hazards 8. some ...
[
Текст
]
Ссылки http://www.geol.msu.ru/obsh/uch_ch2.doc -- 389.0 Кб -- 08.04.2016
[
Текст
]
Ссылки http://geol.msu.ru/obsh/uch_ch2.doc -- 389.0 Кб -- 08.04.2016 Похожие документы
Sites . ... By submitting this form, you are alerting the Google Sites team that this site has content that is in violation of our Terms of Use . If you own the copyright to content on this Site and would like it removed, please see our instructions for notification of copyright infringement . ... This Site contains spam. This Site contains phishing. ... This Site promotes violence or has hate speech. ... This Site contains content that otherwise violates Google Sites Terms of Use . ...
. Московский государственный Университет . им. М.В.Ломоносова . Главная страница . Уставные документы . Об истории физического факультета . Литературная страница . База данных выпускников . Курсовые страницы . Уточнить информацию о выпускнике . 50 лет ССО . Объявления Совета выпусков . Наши реквизиты . Образцы документов . Наши ссылки . Социальная сеть Союза Выпускников . Оформление Гусаковой Д.Ю. , Web-программирование Тарасов А.Б. Тел. Союза выпускников 939-32-84 Administrator
Школа танцев Грация-МГУ . ... Грация-МГУ::Форум Мультимедия Фото . ... Фестос-2011. Любимая "Звездочка" (23 апреля 2011г.) . ... Мая 4 2011, 12:38 . Сообщение #1 . ... Команда 'PhotoTango' выложила свой вотоотчет о 'Звездочке'. Ура 'Грации-МГУ' и 'Фестосу' и до встречи на конкурсе показательных номеров 22 мая. ... Цитата(Sts @ Мая 5 2011, 00:15) . ... Цитата(Braza @ Мая 5 2011, 09:16) . ... Цитата(barsik @ Мая 6 2011, 00:11) . ... Сейчас: 10th Апреля 2016 - 08:29 ...
... Widgetkit is the next generation tool set for Joomla and WordPress. ... All widgets make use of modern web technologies like HTML5 markup, CSS3 features and jQuery based JavaScripts. ... It supports touch gestures and makes use of smooth CSS3 animations. ... Semantic HTML5 markup . ... You can create, edit or delete all widgets and their content in one place. ... escort beylikduzu bayan escort escort bayan escort escort istanbul escort bayan porno film escort istanbul escort beylikduzu escort bayan ...
The Department of Talented Youth Affairs and Professional Orientation . ... Posted on 25.01.2016 by editor . ... The tournament?s basic discipline is biology, working language ? ... Teams from Russia and CIS countries can take part in the Student Biological tournament. ... 2016 - The Department of Talented Youth Affairs and Professional Orientation ...
Заведующий кафедрой Head of the Chair . ... История кафедры . ... В 1966 г. для расширения ведущихся на кафедре научных работ в НИИ Ядерной физики МГУ был создан отдел физики плазмы (ОФП), в 1989 году переименованный в отдел микроэлектроники (ОМЭ). ... Сегодня по различным научным направлениям, ведущимся по специальностям, преподаваемым на кафедре атомной физики, физики плазмы и микроэлектроники, работает около 100 научных сотрудников, среди которых 12 докторов наук и около 50 кандидатов наук. ...
... Lettre Sa B atitude Hieronymos, Archev que d'Ath nes et de toute l'Hellade [Письмо Блаженнейшему Иерониму, Архиепископу Афинскому и всей Эллады] // Вестник Русского Западно-Европейского Патриаршего Экзархата . ... Ключевые слова: официальная часть ; Афон . ... Lettre de notification [Известительная грамота] // Вестник Русского Западно-Европейского Патриаршего Экзархата . ... Ключевые слова: официальная часть . ... Paris 1960 // Вестник Русского Западно-Европейского Патриаршего Экзархата . ...
... Department . ... Contacts . ... The department offices are at the 6th and 7th floor in the Lomonosov MSU 2nd educational building (Faculty of Computational Mathematics and Cybernetics): 714 (scientific secretary of the department), 615a (head of the department), 666, 717. ... CMC Faculty at Google Maps and Yandex.Maps . ... Scientific secretary of the department, Assoc. ... Deparment of the Automation for Scientific Research (ANI) . ... 2008?2016 ASR Department , CMC Faculty , Lomonosov MSU . ...
THE RUSSIAN STYLE OF CIVIL PROCEDURE Dmitry Maleshin Reprinted from Emory International Law Review Volume 21, No. ... 26 See id. ... Another exceptional feature of the Russian civil procedure is the original status of judicial precedent as a source of Russian civil procedural law. ... 98 See OSCAR G. CHASE, LAW , CULTURE, AND RITUAL: DISPUTING SYSTEMS IN CROSS-CULTURAL CONTEXT 53-55 (2005); JAMES ET AL., supra note 6, at 309-10; THOMAS MAIN, GLOBAL ISSUES IN CIVIL PROCEDURE 5 (2006); Oscar G. Chase. ...
... An extended set of observables of the nuclear quasi-free (p, d + ) reaction including the triple differential cross-section for coincidence measurements, its analyzing power in case of polarized proton beams and, also, the parameters of the polarization of the excited recoil nucleus and the produced deuteron are considered in the framework of the distorted-wave impulse approximation using the reaction 16 O(p, d + )15 N at a proton energy of 650 MeV as an example. ...
[
Текст
]
Ссылки http://np-chair.sinp.msu.ru/download/epja100510-offprints.pdf -- 426.2 Кб -- 18.03.2015 Похожие документы