... Кафедра иммунологии Биологического факультета . ... Страница памяти А.А. Ярилина . ... Опубликовано 16/04/2011 20/04/2011 Рубрики immunology-today Добавить комментарий к записи Лекции Тома Хамильтона 21 и 22 апреля . ... Опубликовано 02/12/2010 29/06/2011 Рубрики immunology-today Добавить комментарий к записи Как Т-клетки узнают антиген . ... Опубликовано 20/09/2010 25/09/2010 Рубрики immunology-today Добавить комментарий к записи Научный семинар в рамках курса ?Актуальные проблемы иммунологии? ...
... Journals . Memoirs of the Faculty of Physics . Moscow University Physics Bulletin . ... The conference papers from the School-Seminar ?Waves-2014? will be submitted for publishing in the Memoirs of the Faculty of Physics journal. ... Moscow University Physics Bulletin was founded in 1946 by Lomonosov Moscow State University and the Faculty of Physics. ... World-known physicists working at the Faculty of Physics (including 8 Nobel laureates) used to be and are the authors of the journal. ...
. Search: . Login . Preferences . About Trac . Timeline . Roadmap . Browse Source . View Tickets . Search . Reverse Diff . (No files) . Note: See TracChangeset for help on using the changeset viewer. Unified Diff . Zip Archive . Powered by Trac 0.12.5 . By Edgewall Software . Visit the Trac open source project at . http://trac.edgewall.org/
Faculty of Physics of Lomonosov Moscow State University . ... Department of Photonics and Microwave Physics is one of the largest departments of Faculty of Physics of Lomonosov Moscow State University . ... Our department holds annual conference on wave phenomena in nonhomogeneous media, physics and applications of microwaves in May in Moscow suburb. ... Physics of microwaves . ... Department of Photonics and Microwave Physics . Faculty of Physics . Lomonosov Moscow State University . ...
... 2011 . 2012 ., ... 1) 97% , () 100 96%, 92%; 2) 72%, 85%, , , , 70%. ... 93% 2010 ., ... 100 % () , , 2010 / 2011 , 13 ZYRYANOV V., KOTLOBOVSKY I., SINYAKOV A. UNIVERSITIES PREPAREDNESS TO IMPLEMENT THE FEDER AL STATE : EDUCATIONAL STANDARDS: ORGANI ZATIONAL ASPECT The article continues to present the results of monitoring the implementing effectiveness of the federal state educational standards ( FSES ) of higher education institutions conducted by the Association of Classical ...
[
Текст
]
Ссылки http://www.umo.msu.ru/docs/projects/monitoring/gotov_k_real_fgos_12_12.pdf -- 343.1 Кб -- 01.04.2013 Похожие документы
системы автоматизации, автоматизированные системы , информационные системы , мобильные и встраиваемые системы , программное обеспечение, вычислительные системы , средства связи, базы данных, информационные технологии, технологии программирования, обработка изображения, параллельные вычисления, информационное моделирование , математическое моделирование , вычислительный эксперимент, информатика, методы вычислений, численный анализ, ...
русский english MSU of Lomonosov Higher School . of Policy in Culture . and Administration in Humanities (faculty) . ... Lecturers . Faculty in the people . ... The leading representatives of Russian sport and culture are engaged in teaching at the faculty: . ... Mark A. Gurvich Chairman of Moscow Board of Theatres, . ... Higher School of Policy in Culture and Administration in Humanities (faculty Lomonosov Moscow State University) 2016 . ...
... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...
[
Текст
]
Ссылки http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/poster_mccmb_2011.pdf -- 225.5 Кб -- 21.07.2011 Похожие документы
... взаимодействие языка и культуры в контексте сравнительно-исторических исследований; . ... The Philology Faculty of Moscow State Lomonosov University will hold the VIII International Scientific Conference on Comparative-Historical Linguistics 'Modern methods of comparative historical research', from 25 to 27 September 2013, which is traditionally organized by the Department of General and Comparative-historical linguistics. ... History of Comparative Linguistics. ...
Muller cells are living optical fibers Ё in the vertebrate retina Kristian Franze*, Jens Grosche*, Serguei N. Skatchkov, Stefan Schinkinger§, Christian Foja¶, Detlev Schild , Ortrud Uckermann*, ... California, Berkeley, CA, and accepted by the Editorial Board March 27, 2007 (received for review December 15, 2006) Although biological cells are mostly transparent, they are phase objects that differ in shape and refractive index ... 20 8287 8292 BIOPHYSICS Fig. ... Fig. ... Cell Isolation. ...
[
Текст
]
Ссылки http://cell.biophys.msu.ru/static/announce/media/files/Franze2007_Muller_cell_waveguide.pdf -- 1580.0 Кб -- 01.02.2014 Похожие документы
... The philosophical consequences of synergetics, the interdisciplinary theory of evolution and self-organization of complex systems, are being drawn in the paper. ... Key words: complex systems, evolution, nonlinearity, pre-determination, self-organization, soft management, structure-attractors, synergetics 1. ... The spectra of possible, `allowed' structures correspond to sets of the eigenfunctions of the nonlinear equations describing the evolutionary processes in the complex system. ...
[
Текст
]
Ссылки http://www.students.chemport.ru/materials/Philosophy/orph.pdf -- 61.0 Кб -- 15.01.2009 Похожие документы
1 Вопрос: в каких случаях выгоднее использовать аппаратный маршрутизатор, а в каких -- программный? 1 Ответ: прикидывать по деньгам * в самых простых случаях лучше купить железяку за 50уе (рек. [[ http ://www.dlink.com/][D-Link]]) * в средних случаях _дешевле_ использовать [[ http ://www.freebsd.org/][ FreeBSD5 ]] * в тяжелых случаях (когда может не потянуть шина/процессор/память ядра лучше купить железяку за 50k+уе ([[ http ://www.cisco.com/][Cisco]], [[ ...
Call for Papers September 26-30, 2016 National Cultural Center "Minsk", Minsk, Belar us ICONO/LAT 2016 Int' l Conference on Coherent and Nonlinear Optics (ICONO 2016) Int' l Conference on Laser s, Applications, and Technologies (LAT 2016) The leading event in the area of quantum electronics, laser physics, photonics and their applications. ... Russia Vladimir Belyi, Stepanov Inst. of Physics, NASB, Belar us ICONO Program Vice-Chairs Yulia Vladimirova, Lomonosov Moscow State Univ., ...
[
Текст
]
Ссылки http://iconolat16.phys.msu.ru/download/icono-lat-2016-fcp-reduced.pdf -- 656.9 Кб -- 29.01.2016 Похожие документы
... MSU Chamber Orchestra . Concerts of . ... 1999/2000 season: . MOSCOW . ... German Music of XVII c. Johann ROSENMULLER (1620 - 1684) . ... Leontyevsky pereulok, 6 (metro station "Arbatskaya" or "Pushkinskaya") . ... MSU Chamber orchestra . ... Ulitsa Fadeeva, 4 (metro station "Mayakovskaya") . ... Big Hall of Moscow State University (the building at Vorobievy Gory) . ... MSU CHAMBER ORCHESTRA . ... The tickets are in the Moscow State Philarmony office . ... Big Hall of Moscow State University . ...
... Статистика блога . ... результаты выборов психодиагностика работа с данными скачать SPSS мотивация профессии фото заработок в интернете экспериментальная психология измерение в психологии статьи полезные советы математические методы SPSS Evaluation Version IRT психологические журналы видео ссылки психометрика тестирование компетенции анализ и визуализация данных юзабилити опросы структурное моделирование тесты IBM SPSS Statistics диссертации dropbox графика в R геолокация регрессионный ...
... This is a bug fix release for the 3.x series of Joomla. ... Project and the Production Leadership Team are proud to announce the release of Joomla! 3.5 as the latest in the 3.x series. ... CMS 3.5 Release Candidate 4 . ... CMS, with 3.5 the sixth standard-term support release in this series. ... That being said, please do not upgrade any of your production sites to the release candidate version as a release candidate is ONLY intended for testing and there is no upgrade path from a Release Candidate....
... О кафедре . English . ... Department for Jewish Studies of Lomonosov Moscow State University . ... The Department for Jewish Studies (DJS) was established in 1998. ... The students take courses offered by the School (the Institute of Asian and African Studies), as well as courses offered by the Jewish Studies Department. ... The Department regularly accepts university teachers of Jewish and Israeli Studies from Russia and the FSU in order to upgrade their professional level. ...
... 2 1 2 (2008) 59 available at www.sciencedirect.com journal homepage: www.elsevier.com/locate/ecolmodel The impact of different density stresses on the dynamics of two competitive populations Anatoly T. Teriokhin , Elena V. Budilova Department of Biology, Moscow Lomonosov State University, Moscow 119992, Russia article Article history: info abstract We compare the asymptotic dynamics of two competitive populations described by a ... Second, only the density of youngs can be reduced. ...
[
Текст
]
Ссылки http://ecology.genebee.msu.ru/3_SOTR/CV_Terekhin_publ/2008_R0r_EcolMod.pdf -- 382.8 Кб -- 16.03.2009 Похожие документы