... по всему сайту по геол. сайтам в каталоге в форумах в словаре в конференциях . ... Геология >> Геохимические науки >> Минералогия | Анонсы конференций . ... 20.08.2007 | Е.А. Наумов . ... 1-2 февраля 2007 года на геологическом факультете Пермского государственного университета состоится девятая научная конференция Чтения памяти П.Н. Чирвинского На конференции планируется обсудить проблемы минералогии, петрографии, металлогении и других научных областей входивших в . ... Минералогия . ...
... Публикации . ... 1, 012506 DOI . ... 1, 012509 DOI . ... 1, 103598 DOI . ... Edge field emission of large-area single layer graphene Kleshch V.I., Bandurin D.A., Orekhov A.S., Purcell S.T., Obraztsov A.N. Applied Surface Science, Elsevier BV (Netherlands) DOI . ... Graphene Formation on Surfaces of Single Crystal Metals Shvets P.V., Soon J.M., Verger A., Obraztsov A.N Journal of Nanoelectronics and Optoelectronics, American Scientific Publishers (United States) DOI . ... Материалы, ? ...
... 2009 тАФ Ph.D. in General History (Institute of General History, Russian Academy of Science, Moscow) . ... The mid-French Literary Text: Transition from Manuscript to Incunabula Form and its XV-century Readers. 1995 тАФ MS in the History of Medieval France (Moscow State University, History Department ) . ... Training course in anthropology and cultural studies . ... Central State Museum of the Cinema, Moscow (2009 тАФ to date) . ... State University for Human Sciences, Moscow (2008 тАФ to date) . ...
... Новости лаборатории . ... Yang S., Wei T., Kemnitz E., Troyanov S.I. The Most Stable IPR Isomer of C 88 Fullerene, C s -C 88 (17), Revealed by X-ray Structures of C 88 Cl 16 and C 88 Cl 22 , Chem. ... Lanskikh M.A., Chang K., Tamm N.B., Kemnitz E., Troyanov S.I. Trifluoromethyl derivatives of C 88 (33) fullerene , Mendeleev Commun. (2012) 22 , 136-137. http://dx.doi.org/10.1016/j.mencom.2012.05.007 . ... Chem. ... Copyright 2006-2012, Лаборатория термохимии, Московский государственный университет . ...
Cell Biology International 28 (2004) 139150 Cell Biology International www.elsevier.com/locate/cellbi Vertebrate primary cilia: a sensory part of centrosomal complex in tissue cells, but a "sleeping beauty" in cultured cells? ... Primary cilium in the cell cycle In some cultured cells structure of mature centriole is different from regular one described elsewhere (Vorobjev and Chentsov, 1980, 1982). ... In both cultures we failed to find primary cilium (no cilium for 80 cells in each culture). ...
[
Текст
]
Ссылки http://cellmotility.genebee.msu.ru/html/articles/Alieva04.pdf -- 1066.1 Кб -- 04.03.2004 Похожие документы
... 5-я летняя школа по геометрическим методам математической физики, 23-26 июня 2015 г. new . ... Лаборатория "Геометрические методы математической физики" была создана в декабре 2010г. после объявления победителей гранта Правительства Российской Федерации для государственной поддержки научных исследований, проводимых под руководством ведущих ученых в российских образовательных учреждениях высшего профессионального образования. ... на семинаре "Геометрия и группы" состоится доклад: . ...
... Commission on Paleopedology . ... THE FIRST SCIENTIFIC DESCRIPTION OF EUROPEAN LOESS-PALEOSOL SEQUENCES - Alexander Makeev 08/3/2006 ( 0) . ... paleosol] Re: PalaeoPedology as a Commission - Dr.Stephen Nortcliff 27/11/2003 ( 0) . paleosol] Re: PalaeoPedology as a Commission - dan yaalon 26/11/2003 ( 0) . paleosol] Re: The future of the Paleopedogy Commission - Mermut 28/9/2003 ( 0) . ... Definition of paleosol and geosol; memo to John Catt - Roger Morrison 10/10/99 ( 1) . ...
... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...
[
Текст
]
Ссылки http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/poster_mccmb_2011.pdf -- 225.5 Кб -- 21.07.2011 Похожие документы
... каталоги . ... Введите данные для поиска . ... Каталоги: 51 . БЕН РАН - Журналы БЕН РАН - Каталог книг и продолжающихся изданий ВГБИЛ - Каталог Книги ВГБИЛ - Каталог Периодика ГПНТБ России - Электронный каталог ГПНТБ России ГПНТБ России - Российский сводный каталог по научно-технической литературе ИНИОН РАН - Электронный каталог с 1991 г. БИК.Финуниверситет - Основной каталог БИК.Финуниверситет - Книги Киб НБ МГУ - Электронный каталог Книг c 1990 г. НБ МГУ - Электронный ...
... Biol. (2001) 212, 275 } 294 doi:10.1006/jtbi.2001.2375, available online at http://www.idealibrary.com on Light-triggered pH Banding Pro5le in Chara Cells Revealed with a Scanning pH Microprobe and its Relation to Self-Organization Phenomena A. A. BULYCHEV*, A. A. POLEZHAEV-, S. V. ZYKOV?A, T. YU. ... When exposed to light, internodal cells of Chara and Nitella develop a pattern of alternating acid and alkaline bands along the cell length (Spear et al., ... LIGHT-CONTROLLED PATTERNS FIG. ...
... Alexeyev V.L., Levich A.P. A search for maximum species abundances in ecological communities under conditional diversity optimization // Bull. of Mathemat. ... 1997. ... Bendoricchio G., JЬrgensen S.E. Exergy as a goal function of ecosystems dynamic // Ecological modelling. ... 1999. ... Comolli C.J., Donohue C., Timothy J. Pseudomonas aeruginosa RoxR, a response regulator related to Rhodobacter sphaeroides PrrA, activates expression of the cyanide- insensitive terminal oxidase. ... 1995. ... 2000. ...
[
Текст
]
Ссылки http://dis.bio.msu.ru/States/Fursova_Mil'ko_levich/Spisok.pdf -- 167.3 Кб -- 03.12.2009 Похожие документы
... Leading Research Associate (MSU) . ... Graduated from the Moscow State University, 1960 . PhD, Moscow State University, 1970 . Doctor of Sciences, Moscow State University, 1995 . ... Type of Research: experiment . Research Interests: . ... Graduated from the Moscow Institute of Chemical Technology, 1954 . PhD, Moscow Institute of Chemical Technology, 1958 . Doctor of Sciences, Moscow Institute of Chemical Technology, 1981 . ... Type of Research: experiment, theory . ...
MOSCOW STATE UNIVERSITY The Scientific Society of students of the Law Faculty January 25, 2014 1- The flyer of the Unit `Jurisprudence' of International scientific conference "Lomonosov - 2014" 1. ... The organizers of the Unit are the law faculty of Moscow State University and the Scientific Society of students of the law faculty. ... Administrative law 2. ... The Organizing Committee: Presiding Officer Kozlova Natalya Vladimirovna (Deputy Dean of Law Faculty on study, Doctor in Law, Professor). ...
[
Текст
]
Ссылки http://law.msu.ru/bitcache/bc6ca81fd934d7083472270ea392667daf49eebb?vid=30191&disposition=attachment&op=download -- 260.2 Кб -- 28.02.2014 Похожие документы
... Probe flash (energy/duration) . ... 0.01 J / 0.01 ms . ... Submersible unit (dimension/weight) . Power supply unit (dimensions/weight) . ... 300 x 300 x 50 mm / 1 kg . ... Power supply . ... The complete set of PrimProd fluorometer consists of the following mainframes: submersible probe, 12 DC on-board block power supply, IBM-compatible computer, connecting cables and cable-rope. ... Submersible probe. ... On-board power block provides the necessary voltage (42 V) supply at the submersible probe. ...
Irena Lasiecka ( University of Virginia ) . Nikolai Melnikov (CEMI / MSU) . Mikhail Zelikin (MSU / Steklov Institute) . G. Avalos ( University of Nebraska , USA ) . V. Borisov (MSU, Moscow) . ... O. Emanouvilov ( Colorado State University , USA ) . A. Fursikov (MSU, Moscow) S. Hansen ( Iowa State University , USA ) R. Hildebrand ( Joseph Fourier University , France) V. Komornik ( University of Strassburg, France ) A. Kowalewski ( Institute of Automatics, Poland ) . ... Moscow) . ...
... Положение об олимпиаде . ... Отборочный этап . ... от Оргкомитет олимпиады школьников "Ломоносов" - Четверг, 25 Февраль 2016, 12:10 . ... от Оргкомитет олимпиады школьников "Ломоносов" - Среда, 3 Февраль 2016, 18:52 . ... от Оргкомитет олимпиады школьников "Ломоносов" - Понедельник, 1 Февраль 2016, 17:12 . ... Оргкомитет олимпиады школьников ?Ломоносов? приглашает вас к сотрудничеству с целью организации и проведения заключительного этапа Олимпиады на вашей базе по различным профилям. ...
MOSCOW STATE UNIVERSITY The Scientific Society of students of the Law Faculty January 15, 2013 1 - The flyer of the Unit `Jurisprudence' of International scientific conference "Lomonosov - 2013" 1. ... Administrative law 2. ... Members of the Council of Experts: Golichenkov Alexander Konstantinovich (Head of the Law Faculty, head of the chair of land and ecological law, Doctor in Law, Professor) Romanov Stanislav Vladimirovich (Deputy Dean on instructional work, Candidate in Law, Docent). ...
[
Текст
]
Ссылки http://www.law.msu.ru/bitcache/da2ecb4c4c1ad0c8d4c795e346afcf80b93bd045?vid=25267&disposition=attachment&op=download -- 302.6 Кб -- 25.02.2013 Похожие документы
... About CIE MSU . ... Student's Life . ... About Moscow University . ... Lomonosov Moscow State University . ... About Lomonosov Moscow State University . Lomonosov Moscow State University is the oldest and largest classic university in Russia. ... Every year over 40 thousand students study at the MSU, over 5 thousand are foreign students from 80 countries. ... Foreign students undergo training at the Center for International Education before entering the main faculties of the MSU. ... Students? ...