... The Lectures Contents: Lecture one: Contemporary Historical and Political Background Part One: The Historical Stages of the Arab Political Development Part Two: The Nature of the Arab Political Systems and the Arab Modern Wars Lecture Two: The Middle East Scenario of Crisis and Conflict Part One: The Israeli/Palestine Crisis Part Two: The Superpowers' Role in the Arab Affairs Lecture Three: The Arab Modern Regional Politics Part One: The Arab Politics towards its Unitarian Movements. ...
... О КАФЕДРЕ ? ... ОБЩАЯ ИНФОРМАЦИЯ О КАФЕДРЕ ? ... СОТРУДНИКИ КАФЕДРЫ ? ... Школа ЮНЕСКО / UNESCO SCHOOL . ... заведующий кафедрой ЮНЕСКО по изучению глобальных проблем факультета глобальных процессов МГУ имени М.В.Ломоносова . ... В настоящее время является заведующим кафедрой ЮНЕСКО факультета глобальных процессов МГУ имени М.В.Ломоносова. ... 2005-2013 Факультет глобальных процессов МГУ имени М.В. Ломоносова / Исполнение и поддержка ресурса: Союз молодых ученых и специалистов Евразии ...
... О UNИX . ... Неизменяемая страница . ... Другие действия: Показать разметку Вид для печати Сформатировать как Docbook Очистить кэш страницы ------------------------ Проверить правописание Похожие страницы Карта окрестностей ------------------------ Переименовать страницу Удалить страницу ------------------------ Подписать пользователя ------------------------ Очистить от спама Вернуть эту версию Страницы пакета Синхронизировать ... http://heap.altlinux.org/engine/FrBrGeorge/ALJCourses ...
... Keywords: boundary-layer depth, stable stratification, Ekman layer. ... Experimental data (23) Data sets used in this paper for empirical validation of the proposed SBL depth formulation are taken from three measurement sites ( Figure 1), namely, (i) Cabauw measurement station (Nieuwstadt, 1984; Van Ulden and Wieringa, 1996), (ii) BASIS (Baltic Air-Sea-Ice Study) field experiment (Launiainen, 1999), and (iii) ETH-Greenland expedition in summer 1991 (Ohmura et al., 1992). (i) Cabauw ...
Variability of the specific fluorescence of chlorophyll in the o cean. Part 2. ... Abstract Two methods of determining the chlorophyll a concentration in the sea have been formulated on the basis of artificially induced fluorescence measured with the aid of submersible fluorometers. The method of statistical correlation is founded on the empirical relationship between fluorescence and chlorophyll concentration. ... Variability of the specific fluorescence of chlorophyll in the ocean. ...
... Snecma Moteurs (Groupe Snecma, France) . ... The Colloquium-458, organized by EUROMECH , will take place at Institute of Mechanics of Lomonosov Moscow State University (MSU) . ... The subjects of the Colloquium-458 cover important problems dealing with the verification of constitutive equations, the organization of experiments, the connection between microstructures and mechanical properties and the effective utilization of the modern FEM packages. ... France. ... S.-Petersburg State Techn. ...
Заведующий кафедрой Head of the Chair . ... История кафедры . ... В 1966 г. для расширения ведущихся на кафедре научных работ в НИИ Ядерной физики МГУ был создан отдел физики плазмы (ОФП), в 1989 году переименованный в отдел микроэлектроники (ОМЭ). ... Сегодня по различным научным направлениям, ведущимся по специальностям, преподаваемым на кафедре атомной физики, физики плазмы и микроэлектроники, работает около 100 научных сотрудников, среди которых 12 докторов наук и около 50 кандидатов наук. ...
Influence of Hydrogen Bonding on the Properties of Water Molecules Adsorbed in Zeolite Frameworks A. V. LARIN, 1 2 1,2 D. N. TRUBNIKOV,1 D. P. VERCAUTEREN 2* Department of Chemistry, Moscow State University, Leninskie ... Belgium Received 3 May 2002; accepted 16 September 2002 DOI 10.1002/qua.10496 ABSTRACT: Three hydrated aluminosilicate frameworks-- LiABW , NaNAT, and BaEDI--are partly optimized with the periodic HartreeFock CRYSTAL95 code ... H atom. ...
Special and Extension Programs · Central European University Nador u. 9. ... 361 327 3000/2217 · Fax: +361 327 3190 E-mail: pappa@ ceu .hu ·http://www. ceu .hu/sep/spo SPECIAL PROJECTS OFFICE CEU PROFESSORIAL AND CEU VISITING RESEARCH FELLOWSHIP A program for teachers and researchers holding PhD or equivalent and working in Central and Eastern Europe (except EU countries), former Soviet Union and Mongolia x Research period between one and six mo nths x Publicat ion oriented ...
... VaST is a software tool for finding variable objects on a series of astronomical images. ... VaST performs object detection and aperture photometry using SExtractor on each image, cross-matches lists of detected stars, performs magnitude calibration with respect to the first (reference) image and constructs a lightcurve for each object. ... VaST FITS image viewer ./pgfv . ... Part I" PZP, vol. ... K. V. Sokolovsky, S. A. Korotkiy; "New Variable Stars Discovered by the NMW Survey" PZP, vol. ...
... Следующее сообщение: PARALLEL.RU - Новости, выпуск #349 [23/07/2013] . ... Выпуск 348 . 2 июля 2013 г. ------------- Продолжает работу международная Летняя Суперкомпьютерная Академия, организованная Московским государственным университетом ... факультетом ВМК МГУ, НИВЦ МГУ. 25-26 июня на Академии выступил Thomas Sterling (CREST), 5 июля состоится лекция Dr.Bernd Mohr (JSC). http ://academy.hpc-russia.ru/ ------------- НОВОСТИ МИРА ВЫСОКОПРОИЗВОДИТЕЛЬНЫХ ВЫЧИСЛЕНИЙ http :// parallel.ru / ...
... Faculty of Soil Science, Moscow State University . ... Evaluation of acid deposition effects on soils as a component of forest ecosystems. ... Estimation and prediction of forest soil response to acid deposition with simple process-based models. ... Forest soil response to acid deposition, in particular the significance of soil organic matter in the processes of proton consumption, sulphur retention, aluminium and heavy metals mobilisation was investigated. ... Acid Deposition and Forest Soils. ...
... Зада?а 1. ... Найти длину радиуса-вектора в перигелии и афелии тела массы [pic], совершающего движение в поле гравитационного притяжения массой [pic], если задана вели?ина интегралов движения [pic] и [pic] (см. предыдущую зада?у). [pic] [pic] или [pic] В перигелии и афелии [pic] и, следовательно, [pic] Зависимость [pic] от [pic] при [pic] представлена на рис. 5. [pic] Проанализируем полу?енное квадратное уравнение: [pic] где [pic] При [pic] [pic] [pic] При [pic] [pic] При [pic] [pic] Зада?а 4. ...
Please enter the lightcurve file name and period search parameters: . Lightcurve file: . ... Apply the Heliocentric correction and convert all dates to Terrestrial Time (TT)? ... Also, the Heliocentric correction cannot be applied to such lightcurves. ... This period search service is also available at the mirror sites: Mirror 1 , Mirror 2 , Mirror 3 , Mirror 4 . You may download the latest source code distribution and install the period search service at your own web server. ...
... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...
[
Текст
]
Ссылки http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/poster_mccmb_2011.pdf -- 225.5 Кб -- 21.07.2011 Похожие документы
news ]] . ... Highlight news: CompHEP is in the top rating list on The OpenScience Project . ... 16/03/2009 New official version of CompHEP (4.5.1) is available. ... 14/11/2006 Two new versions of CompHEP-PYTHIA interface (cpyth-1.2.7 and cpyth-2.0.4) are available. ... 13/09/2006 A new version of CompHEP-PYTHIA interface and a new interface CompHEP-HERWIG has been released. ... 01/07/2006 Talk on new physics with CompHEP by M.Dubinin at Tools for SUSY and the New Physics (LAPP, 26-28 June 2006). ...
Координатор семинара : академик РАН и Academia Europaea Алексей Ремович Хохлов . ... Заседания семинара проводятся в Конференц-зале Института элементоорганических соединений им. А.Н. Несмеянова РАН ( ИНЭОС РАН , г. Москва, ул. Вавилова, 28). ... Скачать объявление о семинаре . ... Б.М. Графов (Интститут физической химии и электрохимии имени А.Н. Фрумкина РАН, Москва) . ... После доклада предполагается обсуждение целесообразности организации Общемосковского семинара по электрохимии. ...
... Opening of the educational programme - School of CEOs, "Capsule of security" for the key managers of Bashneft Group. 2013/04/02 - 4:30pm . ... Opening of the educational programme - School of CEOs, "Capsule of security" for the key managers of Bashneft Group. ... April 11, 2013 - Bashneft Group in conjunction with JSFC "Sistema" opened the programme for the development of key Bashneft Group management - School of CEOs, "Capsule of security". ...