... Физический факультет МГУ, 2009 г. Научные интересы: . ... Controllable damping of high-Q violin modes in fused silica suspension fibers. ... Авторы: Дмитриев А.В., Токмаков К.В., Митрофанов В.П. Действие электромагнитных полей на пластичность и прочность материалов (ДЭМП-7), Воронеж, 2007. ... Variant of violin mode damping system for fused silica fiber suspension. Авторы: Дмитриев А.В., Mescheriakov S.D., Tokmakov K.V., Митрофанов В.П. LSC-Virgo March 2009 Meeting, Caltech, Arcadia, USA, 2009. ...
... Химический факультет . Кафедра английского языка . ... На кафедре английского языка химического факультета МГУ была разработана программа дистанционного тестирования, основанная на требованиях по английскому языку, предъявляемым выпускникам средней школы. Данная программа является основой для дистанционного тестирования по английскому языку первокурсников химического факультета МГУ, состоящего из 50 заданий и рассчитанного на 40 минутное прохождение. ...
Revised: 21 May 2014, Accepted: 27 May 2014, Published online in Wiley Online Library (wileyonlinelibrary.com) DOI: 10.1002/jmr.2399 Force -induced globule-coil transition in laminin binding protein and its role for viral- cell membrane fusion Boris N. Zaitseva, Fabrizio Benedettib,e, Andrey G. Mikhaylovb, Denis V. Korneeva, Sergey K. Sekatskiib*, Tanya Karakouzb, Pavel ... 2008, 2010). ... This should permit us to elucidate still unclear aspects of viral-cell membrane interaction and fusion. ...
[
Текст
]
Ссылки http://cell.biophys.msu.ru/static/announce/media/files/Force-induced_globule-coil_transition_in_laminin_binding_protein_and_its_role_for_viral-cell_membrane_fusion.pdf -- 1182.2 Кб -- 30.11.2015 Похожие документы
... Keywords: boundary-layer depth, stable stratification, Ekman layer. ... Experimental data (23) Data sets used in this paper for empirical validation of the proposed SBL depth formulation are taken from three measurement sites ( Figure 1), namely, (i) Cabauw measurement station (Nieuwstadt, 1984; Van Ulden and Wieringa, 1996), (ii) BASIS (Baltic Air-Sea-Ice Study) field experiment (Launiainen, 1999), and (iii) ETH-Greenland expedition in summer 1991 (Ohmura et al., 1992). (i) Cabauw ...
... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...
[
Текст
]
Ссылки http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/poster_mccmb_2011.pdf -- 225.5 Кб -- 21.07.2011 Похожие документы
... The IV Congress of the socio-political . movement 'Nash Dom - Rossiya' ('Our Home - Russia') . ... of the IV Congress of the NDR .. ... Speech delivered at the IV Congress . of the NDR 'On the socio-economic and political situation . in our country and the tasks of the Movement' .. ... Information at the IV Congress of the NDR . ... of the Movement's program' .. ... Political resolution of the IV Congress of the NDR . ... Adressal of the IV Congress of the NDR . ... Lobby in Russia . ...
... The Lectures Contents: Lecture one: Contemporary Historical and Political Background Part One: The Historical Stages of the Arab Political Development Part Two: The Nature of the Arab Political Systems and the Arab Modern Wars Lecture Two: The Middle East Scenario of Crisis and Conflict Part One: The Israeli/Palestine Crisis Part Two: The Superpowers' Role in the Arab Affairs Lecture Three: The Arab Modern Regional Politics Part One: The Arab Politics towards its Unitarian Movements. ...
Application of the V--Ray Technology for Optimization of the TRFD and FLO52 Perfect Club Benchmarks to CRAY Y--MP and CRAY T3D Supercomputers Alexander S. Antonov, Vladimir V. Voevodin Moscow State University, Russia email: voevodin@vvv.srcc.msu.su Abstract The paper shows an application of the socalled V Ray Technology for optimizing the TRFD and FLO52 Perfect Club Benchmarks to CRAY Y--MP and CRAY T3D supercomputers. ... Results for CRAY YMP supercomputers. al structure of the program. ...
... Лаборатория компьютерной безопасности создана совместным решением руководства Московского государственного университета и Федерального агентства правительственной связи и информатики (ныне ФСБ РФ) в 1999 году. ... Задачи лаборатории - разработка специализированного программного обеспечения для защиты информационных ресурсов органов государственной власти и стратегических объектов Российской Федерации. ... Комплекс ТЕСТ, который предназначен для исследования и сертификации программного обеспечения. ...
Кафедра физики . СУНЦ МГУ . ... Кафедра физики готовит команды для участия в: . ... Для связи с кафедрой физики щелкните мышкой по этой строке. ... The installation was constructed for the work in physical practice. ... 3)The picture must be easy to make and represented, no matter of . ... The installation allowed to make holographical pictures of objects with size no more than 35x45mm (because of the parts of the installation) and it allowed to change the "depth" of the picture from 3mm to 40mm. ...
Schools of Philology, Psychology, and of the Arts, Moscow State University held 1-3 October, 2010 an international conference entitled . FREE VERSE AND FREE DANCE: EMBODIED SENSE IN MOTION . ... In addition to paper sessions and thematic round-table discussions, the conference included master classes in free dance & musical movement training, sessions of vers libres, sound poetry, dance and contact improvisation, and site-specific performances. All master classes were open for participants. ...
... О ВШГА МГУ . ... Сбитый прицел . Пора прекратить гордиться высоким кредитным рейтингом страны и срочно повышать эффективность государственных институтов. ... Необходимо отметить, что снижение объема ПИИ в 2005 году четко отразило снижение места России в рейтинге A. T. Kearney, рассчитанного по итогам 2004 года и служившего ориентиром для прямых инвесторов в 2005 году. ... Но высокое место в рейтинге для прямых инвесторов, занятое Россией по итогам 2005 года, не должно вводить в заблуждение. ...
... An extended set of observables of the nuclear quasi-free (p, d + ) reaction including the triple differential cross-section for coincidence measurements, its analyzing power in case of polarized proton beams and, also, the parameters of the polarization of the excited recoil nucleus and the produced deuteron are considered in the framework of the distorted-wave impulse approximation using the reaction 16 O(p, d + )15 N at a proton energy of 650 MeV as an example. ...
[
Текст
]
Ссылки http://np-chair.sinp.msu.ru/download/epja100510-offprints.pdf -- 426.2 Кб -- 18.03.2015 Похожие документы
Department of Physics, Lomonosov Moscow State University . Laboratory "Сryoelectronics" . Laboratory of Cryoelectronics (LCE) was established in the beginning of 1988 on the base of scientific group of Prof. Konstantin K. Likharev originated in 70-th at Physics Department of Moscow State University. ... As it was circumstantially formed, two organizations equipped our laboratory: the Physical Department of MSU and the section of Microelectronics of SIMP (NIIYaF) MSU. ...
... Scientific Effort . ... Cosmic ray astrophysics . Space Physics . ... Nuclear physics . ... The paper was prepared with contributions from Elena Popova from the Skobeltsyn Institute of Nuclear Physics (Lomonosov Moscow State University) and was published in Scientific Reports. ... Federal State Budget Educational Institution of Higher Education M.V.Lomonosov Moscow State University, Skobeltsyn Institute of Nuclear Physics (SINP MSU), 1(2), Leninskie gory, GSP-1, Moscow 119991, Russian Federation . ...
News from the UNESCO Chair on Global Problems Journal 1/2016 Moscow Russian Federation Lomonosov Moscow State University Faculty of Global Processes Dear colleagues, UNESCO Chairholders and members, international scientists, friends! ... When inaugurating the Chair, the Rector of the University Acad. ... The visit of the UNESCO Director General to the Moscow University represents an important milestone for the development of the multifaceted cooperation between UNESCO and the Russian Federation. ...
[
Текст
]
Ссылки http://unesco.fgp.msu.ru/wp-content/uploads/2016/02/Journal-1.2016.pdf -- 712.2 Кб -- 29.02.2016 Похожие документы