... Laboratoire Genetique et Evolution des Populations Vegetales, UMR 8016, CNRS, Universite Lille1, F-59655 Villeneuve d'Ascq, France Department of Biology, Section of ... State University, Leninskiye Gory 1, Moscow 119992, Russia article info abstract UNCORRECTED Article history: Received 13 April 2008 Accepted 30 August 2008 Published online Keywords: Sea beet Evolutionary optimization Resource allocation Dynamic programming Life-history traits Age at ... The Evolution of Life...
[
Текст
]
Ссылки http://ecology.genebee.msu.ru/3_SOTR/CV_Terekhin_publ/2009_Beta_ActaOec.pdf -- 480.1 Кб -- 16.03.2009 Похожие документы
... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...
[
Текст
]
Ссылки http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/poster_mccmb_2011.pdf -- 225.5 Кб -- 21.07.2011 Похожие документы
. If you see this page, the nginx web server is successfully installed and working. Further configuration is required. For online documentation and support please refer to nginx.org . Commercial support is available at nginx.com . Thank you for using nginx.
... List of complexes . ... NPIDB, Nucleic acid ? Protein Interaction DataBase provides an access to structured and organized information about all available structures of DNA ? ... Since 2003, the database is available online. ... NPIDB: nucleic acid?protein interaction database . ... An updated version of NPIDB includes new classifications of DNA-protein complexes and their families . ... Sergey Vasilyev (the main developer of the first version of the database) . ... 03-04-48476 (2003 2005) . ...
Mechmath admission for internetional students . Specialist degree . ... Master degree . ... Master variants . ... About Faculty . ... Mathematics and Mechanics Faculty was created 1 May 1933 with a recovery of the faculty system inљ Lomonosov MSU . ... The faculty prepares high level experts of wide areas of Mathematics, Mechanics and Applying Mathematics , possessing theoretical knowledge and a technique of scientific experiment . ... 2016 Mechmath admission for internetional students ...
... The Lectures Contents: Lecture one: Contemporary Historical and Political Background Part One: The Historical Stages of the Arab Political Development Part Two: The Nature of the Arab Political Systems and the Arab Modern Wars Lecture Two: The Middle East Scenario of Crisis and Conflict Part One: The Israeli/Palestine Crisis Part Two: The Superpowers' Role in the Arab Affairs Lecture Three: The Arab Modern Regional Politics Part One: The Arab Politics towards its Unitarian Movements. ...
JOURNAL OF APPLIED PHYSICS VOLUME 96, NUMBER 1 1 JULY 2004 Theoretical analysis of the synergism in the dielectric strength for SF6 у CF4 mixtures A. V. Larin ґ Laboratoire de Physico-Chimie Informatique, Facultes Universitaires Notre-Dame de la Paix, Rue de Bruxelles 61, B ... Calculated electron energy distribution function EEDF for the SF6 /CF4 mixture solid lines and a pure CF4 dashed lines or b pure SF6 dotted lines vs the electron energy under the same E / N values as given in Table IV. ...
. Компьютерный вариант книги "Numerical Recipes". http://www.nr.com . Guide to Available Mathematical Software . (аннотированный указатель численного программного обеспечения). http://gams.nist.gov . Информационный сайт об обширных коллекциях численных библиотек и пакетах прикладных программ. http://www.netlib.org .
... Antal , T.K., Volgusheva , A.A., Kukarskih , G.P., Krendeleva , T.E., Rubin, A.B. Relationships between H 2 photoproduction and different electron transport pathways in sulfur-deprived Chlamydomonas reinhardtii (2009) International Journal of Hydrogen Energy, 34, pp. ... Antal , T.K., Volgusheva , A.A., Kukarskikh , G.P., Krendeleva , T.E., Tusov , V.B., Rubin, A.B. Examination of chlorophyll fluorescence in sulfur-deprived cells of Chlamydomonas reinhardtii (2006) Biofizika ., 51 (2), pp. ...
sparallel.ru . Мокасины кеддо . Где летние сапоги купить . ... Мягкая стелька обеспечивает комфорт при ходьбе. ... Комфортная обувь для города ? ... Детские ортопедические открытые сандалии TW-110 (белые) обеспечивают комфорт, равновесие и максимальную устойчивость при ходьбе и снижают нагрузку на суставы Посмотреть весь каталог: Детская ортопедическая обувь Особенности: сандалии. Коллекция обуви ?JOOK by Ralf Ringer? появилась в тюменских магазинах сети ?Детский мир?. ... Ricima обувь . ...
... Results of experimental and numerical investigations of a permeable round parachute with the stripe-stabilizer, the so called "SAL" parachute - Stabilization of Aerodynamic Loads, are given [1]. ... The parachute canopy attained different shapes from each other depending on the value of reefing ( Fig.1 ). ... As given below some numerical investigations of the stripe-stabilizer reefing influence on the canopy shape, its aerodynamic drag and the tension of radial ribbons are considered. ...
G.F.Hoffmann in Moscow . Introduction by M.G.Pimenov . G.F.Hoffmann GENERA PLANTARUM UMBELLIFERARUM Mosquae 1814 . G.F.Hoffmann PLANTARUM UMBELLIFERARUM GENERA Mosquae 1816 . Plant Name Index 1814 & 1816 . G.F.Hoffmann Syllabus Umbelliferarum officinalium 1814 & 1816 . B.M.Koso-Poljannsky To 100-year anniversary of Hoffmann's book "Genera Umbelliferarum" Yuriev, 1914 (in Russian) . S.Yu.Lipschitz G.F.HOFFMANN Moscow, 1940 (in Russian) . Hoffmann's herbarium in MW . ...
. HOME . ABOUT . RESEARCH . NEWS . PUBLICATIONS . DATA . COLLABORATION . OUTREACH . CONTACT US . outreach . ПРЕЗЕНТАЦИИ Panasyuk M. (SINP, Russia). Relec . ШКОЛЬНИКАМ Using a database of university satellite "Vernov" in school project work. Использование данных университетского спутника "Вернов" в школьных проектах. Experiment and database description | Описание эксперимента и базы данных(doc file ~6 Mb) . Database files (FTP archive) | Файлы данных (FTP-архив) .
... He distributes these gifts in sacks (each sack can contain from 1 to n items) and puts the sacks with gifts around the Christmas tree (only the content of the sacks and their ordering on the circle around the tree are important). ... A river falling into a sea forms a delta which is a system of branches consisting of channels without inner intersections. (a) Suppose that in a given delta there are exactly n different (i.e. differing by at least one channel) routes down the stream. ...
Call for Papers September 26-30, 2016 National Cultural Center "Minsk", Minsk, Belar us ICONO/LAT 2016 Int' l Conference on Coherent and Nonlinear Optics (ICONO 2016) Int' l Conference on Laser s, Applications, and Technologies (LAT 2016) The leading event in the area of quantum electronics, laser physics, photonics and their applications. ... Russia Vladimir Belyi, Stepanov Inst. of Physics, NASB, Belar us ICONO Program Vice-Chairs Yulia Vladimirova, Lomonosov Moscow State Univ., ...
[
Текст
]
Ссылки http://iconolat16.phys.msu.ru/download/icono-lat-2016-fcp-reduced.pdf -- 656.9 Кб -- 29.01.2016 Похожие документы
1, 120101 (2012) : . 119991, , , . ... Alternative core environmental mo dule for students : features of the foundations of ecology from the physics p ositions V. A. Gordienko 1 1,a , K. V. Pokazeev 2,b , M. V. Starkova 3,c 3 M. V. Lomonosov Moscow State University, Physical Faculty, Department of Acoustics. ... Keywords : ecology and environmental management, environmental education, a systematic approach to the ecology and current environmental problems, modeling and prediction in ecology. ...