... The data on UV glow of the atmosphere obtained in operation of one pixel of the TUS detector on board the Moscow State University "Universitetsky-Tatiana" satellite was taken into account in design of the updated TUS detector. ... The main feature of the design is use of MEMS technology scanning mirror controlled by the TUS computer, analyzing the recorded EAS data and directing the laser to the atmosphere spot, where back scattered Cherenkov light came from. ... Monitoring of UV intensity on-route....

Еще в разделе: (Показать все результаты (>2) - cosrad.sinp.msu.ru/ )

• http://cosrad.sinp.msu.ru/experiments/tus/doc/Ponce2007fin.pdf

... Kornev, V., Sharafiev, A., Kolotinskiy, N., and Mukhanov, O. Microwave dynamics of superconducting quantum cell.љ ... DOI љ] . Kornev, V.љK., Kolotinskiy, N.љV., Skripka, V.љA., Sharafiev, A.љV., and Mukhanov, O.љA. Output power and loading of superconducting quantum array.љ ... V.љKornev, N.љKolotinskiy, A.љSharafiev, and O.љMukhanov. ... Kornev, V., Sharafiev, A., Soloviev, I., and Mukhanov, O. Signal and noise characteristics of bi-squid.љ ... Physics of Wave Phenomena 21 , 4 (2013), 294?299. ...

Еще в разделе: (Показать все результаты (>9) - cryolab.phys.msu.ru/ )

• Victor K. Kornev
• Publications (2001-2010)

.

Еще в разделе: (Показать все результаты (>2) - lab110.imec.msu.ru/ )

... Lomonosov Moscow State University . ... Home About Communication and Information Department . ... Our main areas of expertise are information exchange, building network partnerships, development of complex internet applications and solutions, implementing e-learning practices.б  . ... Dr. of Science (biology) Alexander O. Makeev Graduated from Geographic Faculty of Lomonosov Moscow State University. ... Alexander Ladygin graduated from department of Biology of Lomonosov Moscow State University. ...

Еще в разделе: (Показать все результаты (>14) - ecfs.msu.ru/ )

• Topic 1: Building the Eurasian Food Security Network / Создание Евразийской
• Topic 2: Barriers to Sustainable Soil Management in Eurasia / Барьеры на пути к
• International Forum on Eurasian Food Security and Nutrition Network and

... 11-May-2003 13:06 . ...

Еще в разделе: (Показать все результаты (>4) - textbook.sinp.msu.ru/ )

• Index of /modules/ax_content/atomax/spaw/lib/themes/classic/img

... Координационный совет МГУ по технологиям дистанционного образования . Центральный узел Системы дистанционного обучения и информационная среда дистанционного обучения (ИСДО) МГУ . ... В Московском университете создан Центральный узел Системы дистанционного обучения и разработана единая среда дистанционного обучения (ИСДО) МГУ http://test.sdo.msu.ru/ . ... треххузловой кластер сервера приложений и баз данных (три четырехпроцессорных (Xeon 1.9 MP) компьютера Futjitsu-Siemens); . ...

Еще в разделе: (Показать все результаты (>2) - www.inpro.msu.ru/ )

... О кафедре . Кафедра суперкомпьютеров и квантовой информатики . ... Кафедра проводит обучение по образовательной программе шестилетней интегрированной подготовки высококвалифицированных специалистов с последовательным освоением образовательной программы бакалавриата (4 года) по профилю ?Системное программирование и компьютерные науки? и образовательной программы магистратуры (2 года) по двум магистерским программам: ?Суперкомпьютерные системы и приложения? и ?Квантовая информатика?. ... ИПМ РАН . ...

Еще в разделе: (Показать все результаты (>3) - sqi.cs.msu.su/ )

• Учебно-методические комплексы по курсам, читаемым преподаватлями кафедры ?

. Posted by Edwin abaimun 03 Sen 2002 03:03:20 . hello sir, . I do not have the text book."thunder books.And i want to know more about the pedological thoughts,methods and concept of soil. I will be very grateful sir if i can get the answer soonest.I am a student of olabisi onabanjo university Nigeria. Edwin Abaimun. need a diploma form maisamari victor 28/4/2005 ( 1) . Diploma Abdenbi ERRAJI 04/1/2007 ( 0) .

Еще в разделе: (Показать все результаты (>2) - www.paleopedology.msu.ru/ )

• http://www.paleopedology.msu.ru/discussions/messages/128.html

... Доктор филологических наук профессор Юрий Николаевич МАРЧУК является видным специалистом по прикладной и компьютерной лингвистике , машинному переводу, автоматическому анализу и синтезу текстов, терминологии и терминоведению, лексикологии и лексикографии, общему языкознанию. ... Белов Алексей Михайлович, преподаватель, кандидат филологических наук . ... Качалкин Анатолий Николаевич, профессор, доктор филологических наук . Кочергина Вера Александровна, профессор, доктор филологических наук . ...

Еще в разделе: (Показать все результаты (>34) - genhis.philol.msu.ru/ )

... My field of specialization is Stability Theory, Nonlinear Dynamics, Asymptotic Methods, Mechanics of Solids, System Identification, Optimal Control, Economic Growth. ... A.O. Belyakov and A.P. Seyranian (2012). ... A.O. Belyakov and A.P. Seyranian, . ... A.P. Seyranian and A.O. Belyakov, Swing dynamics. ... A.O. Belyakov, A.P. Seyranian, and A. Luongo, Regular and chaotic dynamics of the swing. 6th EUROMECH Nonlinear Dynamics Conference (ENOC 2008) , Saint Petersburg, Russia, June, 30 - July, 4 2008...

Еще в разделе: (Показать все результаты (>10) - belyakov.imec.msu.ru/ )

СПИСОК И АННОТАЦИИ КУРСОВ МАГИСТЕРСКОЙ ПРОГРАММЫ 'ФИЗИКА МАГНИТНЫХ ЯВЛЕНИЙ' . ... Физика магнитных явлений, часть II) ( гнс Е.Е. Шалыгина) . ... Физические основы современной магнитной записи ( гнс Зубов В.Е.) . ... Спецкурс предназначен для студентов магистров, специализирующихся в области физики конденсированного состояния вещества. ... Спецкурс предназначен для студентов магистров, специализирующихся в области физики конденсированного состояния вещества, физики магнитных явлений и материаловедения. ...

Еще в разделе: (Показать все результаты (>9) - magn.phys.msu.ru/ )

• http://magn115.phys.msu.ru/Rus/DETI2/smekhova.html
• Collaboration
• Сотрудники кафедры магнетизма: Родионова Валекрия Викторовна

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>3) - mouse.genebee.msu.ru/ )

... Each day a different image or photograph of our fascinating universe is featured, along with a brief explanation written by a professional astronomer. June 21, 1999 . The Galactic Center in Infrared . ... Explanation: The center of our Galaxy is a busy place. In visible light , much of the Galactic Center is obscured by opaque dust . In infrared light , however, dust glows more and obscures less, allowing nearly one million stars to be recorded in the above photograph . ...

Еще в разделе: (Показать все результаты (>9) - www.arcetri.astro.it/ )

• APOD: June 16, 1998 - An Active Region of the Sun

... The latter should be taken into account and carefully modeled as a fluid-structure interaction (FSI) problem. A patient- specific FSI analysis is impossible because it predicts only estimated hemodynamic features which are based on assumptions regarding material properties. The objective of this study is to develop a new methodology that assimilates medical imaging data for quantitative hemodynamic data extraction. ...

Еще в разделе: (Показать все результаты (>11) - hit-conf.imec.msu.ru/ )

• http://hit-conf.imec.msu.ru/books/NeZaTeGiUs_2010.pdf
• http://hit-conf.imec.msu.ru/2014/downloads/Program.pdf

... Chemically Decoupled Nuclei in Five Lenticular Galaxies from SAURON Data O. K. Sil'chenko* Sternberg Astronomical Institute, Universitetski i pr. ... We have now analyzed and published the SAURON data for five galaxies, including the above NGC 3384 and NGC 3623, in which the chemically decoupled nuclei are rather extended (several hundred parsecs) circumnuclear stellar disks. ... 1996 SAURON, Oct. ... In NGC 7280, we found an inner polar ring previously using MPFS data (Afanasiev and Sil'chenko 2000...

Еще в разделе: (Показать все результаты (>27) - sn.sai.msu.ru/ )

• http://sn.sai.msu.ru/~sil/preprints/ic3653.pdf
• http://sn.sai.msu.ru/~sil/preprints/expsauron.pdf

... The study of adaptive variability, i.e. the study on the population level of the physiological adaptation of the human organism to a variety of environmental conditions, is the main purpose and the basic principle of physiological anthropology. ... Regional rates of hormonal activity of indigenous population of different ethno-territorial groups that we have elaborated broaden our notions about common conformities of age variability and aging and the reasons of these processes. ...

Еще в разделе: (Показать все результаты (>19) - www.anthropos.msu.ru/ )

• http://www.antropos.msu.ru/vestnic/pravila_eng.doc
• НИИ и Музей антропологии | Вестник Московского университета. Серия XXIII.

... О факультете . ... Master In Ecology . Master In Nanobiotechnology . ... Nanobiotechnology and Biophysics? is intended for prospective highly qualified professionals with in-depth knowledge in of modern biophysics, molecular biology and nanobiotechnology. ... The program is focused at problems of modern nanobiotechnology, biophysics and proteomics, and hence it consists of the two parts: lectures/seminars and laboratory work. ... Lectures / Practical . ... Биологический факультет МГУ . ...

Еще в разделе: (Показать все результаты (>3) - www.bio.msu.ru/ )

... Окончила ряд дистанционных курсов для повышения информационной компетенции преподавателей английского языка ('E-Moderation Skills', 'Webheads in Action', курсы от Британского совета и TESOL). С 2005-2009 гг. вела дистанционный подготовительный курс английского языка в качестве тьютора и принимала активное участие в организации регулярных видео-конференций между студентами факультета и студентами университета Slippery Rock University (штат Пенсильвания). ...

Еще в разделе: (Показать все результаты (>3) - dist.ffl.msu.ru/ )

The Shigeyoshi Matsumae Stadium in Moscow University was opened on September 1, 1989, on the campus of Moscow University, as the first full-scale stadium having artificial turf in the Soviet Union (at that time). ... The stadium was a gift by Tokai University to Moscow University, as the result of more than 20 years of exchange and friendship between Tokai University and Moscow University in exchanging students and teachers, as well as academic and cultural works since 1973. ...

Еще в разделе: (Показать все результаты (>2) - mguteam.chat.ru/ )

... Геология >> Геотектоника | ... Добавить новое сообщение . ... Учебное пособие "Введение в тектонофизику". Гончаров М. А., Талицкий В. Г., Фролова Н. С. Ответ. ... Тезисы научной конференции ЛОМОНОСОВСКИЕ ЧТЕНИЯ, ноябрь 2011 года СЕКЦИЯ ГЕОЛОГИЯ: . ...

Еще в разделе: (Показать все результаты (>8) - phys.web.ru/ )

• Тезисы научной конференции ЛОМОНОСОВСКИЕ ЧТЕНИЯ, ноябрь 2011 года СЕКЦИЯ
• Учебник по экспериментальной и технической петрологии - Все о Геологии
• Все о геологии :: Анонсы конференций - Поиск и разведка месторождений полезных