... Авторский указатель . ... Морфология клеток и колоний диссоциантов бактерий . ... 1) Влияние срока внесения стероидного субстрата и количества посевного материала на скорость трансформации 5альфа-Н-прегн-16-ен-3бетта-ол-20-она (2а) Rhodococcus sp. ... Steroid transforming activity of dissociative variants of Rhodococcus sp. ... 2) Content of Steroids (%) in Culture Fluid of S and R Variants of Rhodococcus sp. 77 after Transformation of Compounds I and Ia for 12 and 24 h , DJVU-файл, 6 Кб . ...

Еще в разделе: (Показать все результаты (>12) - dis.bio.msu.ru/ )

THE LABORATORY OF CHEMISTRY AND PHYSICS OF SENSOR AND SEMICONDUCTOR MATERIALS . ... The active sites on the surface of the nanocrystalline metal oxides and specificity of their interactions with nitrogen-containing organic compounds . ... Selected synthesis methods allow to control the composition and content of the resulting materials used modifiers (SiO 2 , Al 2 O 3 , Cr 2 O 3 , Nb 2 O 5 , Au). ... 2008-2014 The Laboratory of chemistry and physics of sensor and semiconductor materials. ...

Еще в разделе: (Показать все результаты (>12) - www.lssm.inorg.chem.msu.ru/ )

• The Laboratory of chemistry and physics of sensor and
• The Laboratory of chemistry and physics of sensor and semiconductor materials |

... Run source ./setup.csh 6. ... When you will start to work next time, run setups in following order : cd /data1/atlas/work source ../software/12.0.8/setup.csh cd testarea/12.0.8/ source $ATLAS_ROOT/../work/cmthome/setup.csh -tag=12.0.8 To exclude first two lines, just add to your .login these lines : # add Atlas env-s : source /data1/atlas/software/12.0.8/setup.csh After that next time just do : source $ATLAS_ROOT/../work/cmthome/setup.csh -tag=12.0.8 cd /data1/atlas/work/testarea/12.0.8/ . ...

Еще в разделе: (Показать все результаты (>18) - lhe.sinp.msu.ru/ )

• MSU.ru Atlas computing
• Brief CompHep Installation Instruction

sparallel.ru . Older posts . Newer posts . Posted by admin . ... Есть некоторые условия по эксплуатации автоматов для чистки обуви. Continue reading . Posted in Разное . Апр 04 . ... ЛЬВОВСКАЯ ОБУВНАЯ ФАБРИКА предлагает Одежда, обувь купить Украина, Львов по самым низким ценам SPRAVKA . ... Я уже писала, что обувь мне найти трудно, т. Continue reading . ... Posted in Кросовки . ... Posted in Ботинки . ... Черутти обувь . ... Тигина обувь каталог . ... Разное . ...

Еще в разделе: (Показать все результаты (>3) - sparallel.ru/ )

• sparallel.ru - Part 28

. Евгений Вареник, 28 февраля 2006 . Схема Горнера вычисления значения полинома в точке. Доказательство ее оптимальности в худшем случае по числу операций "сложение" и "умножение" среди алгоритмов, использующих только эти операции. Материалы к докладу: . E.M. Reingold and A.I. Stokes, Simple proofs of lower bounds for polynomial evaluation, in: R.E. Miller and J.W. Thatcher, Eds., Complexity of Computer Computations (Plenum, New York, 1972) 21--29.

Еще в разделе: (Показать все результаты (>3) - al.cs.msu.ru/ )

... Дистанционное обучение . Learning and Teaching with the Web . ... Multimedia Educational Resource for Lerning and Online Teaching . ... Foreign Language Teaching Forum . Center for Enhancement of Teaching and Learning . Resources for Teaching . ... The European Association for Distance Learning . European Distance and e-Learning Network . ...

Еще в разделе: (Показать все результаты (>14) - anazarenko.ffl.msu.ru/ )

... О кафедре . ... Научная работа . ... Главная Научная работа Математические модели взаимодействия элементарных и структурированных объектов . ... Ведущий научный сотрудник Эльтеков В.А. В разное время в состав группы входили: Н.Н.Шапошников, А.В.Овсянкин, В.Б.Шикалов, Н.Г.Васичкина (кафедра математики), Л.П.Развина, О.В.Попова, Н.Н.Негребецкая (кафедра физической электроники), В.Н.Самойлов, Н.Г.Ананьева (кафедра общей физики). ... Кафедра математики физического факультета МГУ им. М.В. Ломоносова . ...

Еще в разделе: (Показать все результаты (>11) - matematika.phys.msu.ru/ )

• Кафедра математики Физического Факультета МГУ им. М.В. Ломоносова | Наши

... Исследователи химического факультета МГУ представили проект моделирования молекулярной динамики опасных вирусов . ... Владимир Пентковский, известный разработчик программно-аппаратных архитектур, заслуженный исследователь Intel, обладает большим опытом создания научных коллективов в России, США и Индии. ... 2003 2011 MsuNews.Ru Новости МГУ . ... Экспорт новостей (RSS) ...

Еще в разделе: (Показать все результаты (>49) - www.msunews.ru/ )

• MsuNews.Ru | Новости МГУ | Профессор Стэнфордского университета рассказал
• MsuNews.Ru | Новости МГУ | Grant program of McKinsey Company Business
• MsuNews.Ru | Новости МГУ | Суперкомпьютер 'Ломоносов' Московского университета

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>6) - mouse.genebee.msu.ru/ )

... Also, if events can be split up into distinct but overlapping events, how do you approximate the fluences of the individual events? ... In any cases, You can observe new increasing the E>30 MeV fluxes after first event. ... And for that case, what should be difference in fluences, predicted by different models. ... Fig. ... For different SEP model characteristics were used different events sets. 183 were physical events, what were used for development of the regularities, inherent to the SEP events....

Еще в разделе: (Показать все результаты (>6) - srd.sinp.msu.ru/ )

... Web portal on atmospheric environment is developed by international consortium as a be-lingual information resource in area of atmospheric physics and chemistry and in related domain air quality assessment and management. ... The portal has all typical component and services like collections of links, user group registration, discussion forum, etc. ... Each scientific site is an information-computational system designed in Internet technologies. ... 00189 138. ... 2003 . ... 2002, 252 . ...

Еще в разделе: (Показать все результаты (>6) - geophys.srcc.msu.ru/ )

... Unemployment of graduates combined with a shortage of highly educated young people is putting the European governments under pressure to act. ... The Bologna Declaration explicitly mentions the lack of competitiveness of European Higher Education institutions. The signatory countries actually explicitly express their goal to "ensure that the European higher education system acquires a world- wide degree of attractiveness equal to [Europe's] extraordinary cultural and scientific traditions". ...

313. Полезные ссылки | hpc@cmc

314. Anton O. Belyakov

315. Магистратура ВМК МГУ - подготовка ERP-программистов, консультантов SAP

316. http://xray.sai.msu.ru/~polar/sci_rev/0308.html

317. http://heritage.sai.msu.ru/ucheb/Knyazev/Lect_N4.ps

318. Udall, Nicholas. Ralph Roister Doister

319. http://oc.cs.msu.su/smirnov/PPP/beameruserguide.pdf

320. http://rswater.phys.msu.ru/en/articles/2014/jalcom.pdf