... The experimental data obtained using Cherenkov light of EAS reflected from the snow surface of the Big Alma-Ata Lake (Kazakhstan) are presented. ... The balloon-borne measurements in the energy range 10 15 -10 20 eV are planned. ... SPHERE detector array was elaborated for balloon-borne experiment [3-5]. ... SPHERE detector was situated on the 160 m high mountain ledge nearby the B.Alma-Ata lake (2500 m above sea level) to detect Cherenkov light reflected from the snow surface of the lake. ...
... When embedded within a base document, a URL in its absolute form may contain a great deal of information which is already known from the context of that base document's retrieval, including the scheme, network location, and parts of the url-path. ... Introduction This document describes the syntax and semantics for "relative" Uniform Resource Locators (relative URLs): a compact representation of the location of a resource relative to an absolute base URL. ... 3.1) Base URL embedded in the | ...
Published on Совет молодых ученых ВМК МГУ ( http://smu.cmc.msu.ru ) . Главная > Мероприятия > Конференция ?Ломоносов? > 2013 . ... XX Международная конференция Ломоносов-2013 проходит с 9 по 12 апреля 2013 года. Официальный сайт конференции Ломоносов -љ http://lomonosov-msu.ru [1] . ... Руководители: Шевцова Ирина Геннадьевна, Нефедова Юлия Сергеевна . ... Ответственный секретарь љ? ассистент к.ф.-м.н. Шевцова Ирина Геннадьевна . ... Программа секции ВМК 9-11 апреля 2013г. [3] . ...
Published on Совет молодых ученых ВМК МГУ ( http://smu.cs.msu.ru ) . Главная > Мероприятия > Конференция ?Ломоносов? > 2013 . ... XX Международная конференция Ломоносов-2013 проходит с 9 по 12 апреля 2013 года. Официальный сайт конференции Ломоносов -љ http://lomonosov-msu.ru [1] . ... Руководители: Шевцова Ирина Геннадьевна, Нефедова Юлия Сергеевна . ... Ответственный секретарь љ? ассистент к.ф.-м.н. Шевцова Ирина Геннадьевна . ... Программа секции ВМК 9-11 апреля 2013г. [3] . ...
Published on Совет молодых ученых ВМК МГУ ( http://smu.cs.msu.su ) . Главная > Мероприятия > Конференция ?Ломоносов? > 2013 . ... XX Международная конференция Ломоносов-2013 проходит с 9 по 12 апреля 2013 года. Официальный сайт конференции Ломоносов -љ http://lomonosov-msu.ru [1] . ... Руководители: Шевцова Ирина Геннадьевна, Нефедова Юлия Сергеевна . ... Ответственный секретарь љ? ассистент к.ф.-м.н. Шевцова Ирина Геннадьевна . ... Программа секции ВМК 9-11 апреля 2013г. [3] . ...
... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...
[
Текст
]
Ссылки http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/poster_mccmb_2011.pdf -- 225.5 Кб -- 21.07.2011 Похожие документы
Кафедра общей топологии и геометрии . ... Публикации . ... Сипачева О.В. , The Topology of Free Topological Groups, Journal of Mathematical Sciences, vol. 131, no. 4, 2005, pp. ... Сипачева О.В. , Топология свободной топологической группы, Общая топология и топологическая алгебра. ... Резниченко Е.А. , Сипачева О.В. , The Fr\'echet--Urysohn and $\alpha_2$-properties in separable spaces, groups, and locally convex spaces, 13th Summer Conf. on General Topology and Its Applications, Mexico, 1998, pp.~ ...
The beamer class Manual for version 3.06. \begin{frame} \frametitle{There Is No Largest Prime Number} \framesubtitle{The proof uses \textit{reductio ad absurdum}.} \begin{theorem} There is no largest prime number. \end{theorem} \begin{proof} \begin{enumerate} \item<1-| alert@1> Suppose $p$ were the largest prime number. \item<2-> Let $q$ be the product of the first $p$ numbers. \item<3-> Then $q+1$ is not divisible by any of them. \item<1-> Thus $q+1$ is also prime and greater than $p$.\qedhere
... Gpu | ... 10 , MULtI- GPU ABSoft Neat Video Adobe After Effects CC Autodesk Flame Premium Boris FX Continuum Complete Cinnafilm Dark Energy Plug-in CoreMelt complete eyeon Fusion GenArts Monsters Gt GenArts Sapphire roBUSKEY Neat Video open FX NewBlueFX Video Essentials NewBlue titler Pro Pixelan AnyFX re:Vision Effects red Giant Effects Suite red Giant Magic Bullet Looks the Foundry HIEro the Foundry NUKE and NUKEX Video Copilot Software Element 3D ... Q=Quadro Gpu, T=Tesla Gpu. ...
[
Текст
]
Ссылки http://ccoe.msu.ru/sites/default/files/RU_Apps_Catalog_Sep13_LR.pdf -- 131.1 Кб -- 10.12.2013 Похожие документы
... Совместно с сотрудниками физического факультета МГУ предложена простая конечномерная модель геодинамо, полученная из уравнений электродинамики средних полей и воспроизводящая феномен инверсий геомагнитного поля (рис 1). ... Сейсмические рои были подвергнут анализу согласно разработанной на кафедре физики Земли методике: были оценены параметры сейсмического режима роев и исследованы их вариации во времени. ... сотрудников кафедры физики Земли за 2010-2011 год. ... Вестник Московского университета. ...
... In my opinion, it became the landmark for Russian education. ... This means academic mobility, joint scientific research, joint development of new forms of evaluation of the quality of education, including new mechanisms of the global rating of institutions of higher education. All this will contribute to prevention of the current trend to breakage of ties between the key subjects of the educational process: students' and teachers' corporations, employers, state and social institutes. ...
... На факультете журналистики МГУ с 14 по 17 декабря будет проходить XXXIII Международная конференция Общества по изучению культуры США, которая в этом году посвящена теме 'Междисциплинарное изучение американской культуры как сферы контактов'. ... Он зачитал участникам школы приветствие директора ГАИШ академика РАН А.М. Черепащука, в котором указал на актуальность школы в связи с тем, что грядущий век будет веком астрономии в целом и астрометрии в частности. ... Релятивистская астрометрия . ...
... 000, 112 (2009) Printed 11 February 2010 A (MN L TEX style file v2.2) Analytical approximations of K -corrections in optical and near-infrared bands I1gor V. Chilingarian1 2 ,2,3 , Anne-Laure Melchior 1,4 and Ivan Yu. ... Received 2010 February 01; in original form 2009 August 14 ABSTRACT To compare photometric properties of galaxies at different redshifts, the fluxes need to be corrected for the changes of effective rest-frame wavelengths of filter bandpasses, called K -corrections. ... Table 1. ...
Communicating Through Art, L.Vershbow . ... But here I am, and as a designer, I will attempt to explain to you how I perceive art and design as a form of communication. Most of us think of art as the works that hang in museums and on the walls of our homes. ... But art, design and symbols, whether they are aesthetically pleasing or not, are all around us, and they help to guide us through the complexities of everyday society. ... Today I am a designer and creator of contemporary jewelry. ...
BS - 2D data processing program. BS is a windows version of the 2D X-ray data processing program BSL in use at the Daresbury Synchrotron radiation source, for the treatment of low angle diffraction data. ... It requires less memory, has separate window to see 1D graphics and allows export of the image in two common formats: BMP and TIFF. ... information about the data file .adc . add a constant to selected range in n frames from file .add . weighted addition of two images .arg . ...
... Количественные методы оценки темпов звездообразования по наблюдениям в различных диапазонах спектра . ... Распределение областей звездообразования по диску галактик . ... в) звездообразование в ядерных дисках . ... On the size and formation mechanism of star complexes in Sm Im and BCD galaxies" //ApJ467,579 . ... Cepa & de Pablos "Star formation rates, efficiencies and initial mass functions in spiral galaxies" // 1997 Star formation near and far conference series: sfnf.conf.433D . ...
New Series of Editions from the History Faculty of MSU . ... Historical Research . ... Through the publication of programs of general courses, the History Faculty of MSU opens a series of works designed to reflect the results of the most important research currently being conducted within the faculty, as well as to represent the experience gained through the teaching of historical disciplines. ... The first series of works published by the History Faculty of MSU is "Historical Sources". ...