Software on Data Processing . We Offer Statistical Software And . Software On Data Analysis And Processing. ... The package is intended for those, who doesn't have large experience in statistical analysis, but needs a quick and convenient data processing tool. ... Package provides full complex of registration and analysis methods, individual EKG monitor-analyzer, special tools for complete polygraph analysis. price: 700$ - 2200$. phone number (095) 437-3695, 155-1365 . ... InCo . ...
... Atmospheric and Oceanic Boundary Layer Physics V. Lykossov 3.1 Introduction The globe of the earth is surrounded by a gaseous atmosphere which is always in motion. ... One of the most important problems is the parameterization of the turbulent uxes of momentum, latent and sensible heat at the sea surface. ... In the atmospheric surface layer, typically the lower 10 % of the boundary layer, the turbulent uxes of momentum, water vapor and sensible heat are nearly constant with height. ...
... Название шкалы в опроснике для клиента (1987 просмотра) . ... Psyling . Написано: 2009-08-13 18:15 . Столкнулся с тем, что в опроснике депрессии Бека на английском языке перед вопросами, которые даются клиенту, есть название шкалы: Sadness, Loss of energy (всего 21). В то же время, в одной из русских версий http://www.hr-portal.ru/node/8214 даются просто вопросы, типа Мне так грустно или печально, что я не могу этого вынести. ... Я к тому, что шкалы лучше не называть. ...
Muller cells are living optical fibers Ё in the vertebrate retina Kristian Franze*, Jens Grosche*, Serguei N. Skatchkov, Stefan Schinkinger§, Christian Foja¶, Detlev Schild , Ortrud Uckermann*, ... California, Berkeley, CA, and accepted by the Editorial Board March 27, 2007 (received for review December 15, 2006) Although biological cells are mostly transparent, they are phase objects that differ in shape and refractive index ... 20 8287 8292 BIOPHYSICS Fig. ... Fig. ... Cell Isolation. ...
[
Текст
]
Ссылки http://cell.biophys.msu.ru/static/announce/media/files/Franze2007_Muller_cell_waveguide.pdf -- 1580.0 Кб -- 01.02.2014 Похожие документы
... We thank the Swift team for their rapid scheduling of this observation. ... 2455705.20851 V 14.15 0.03 2455707.83079 V 14.10 0.03 2455710.84028 V 13.53 0.02 2455713.64631 V 13.66 0.02 2455714.65479 V 14.11 0.03 2455714.71823 V 14.12 0.02 2455714.78596 V 14.20 0.02 2455717.39593 V 14.37 0.03 2455726.62861 V 14.83 0.04 2455727.16343 V 14.57 0.04 2455730.50586 V 14.57 0.03 2455730.57329 V 14.56 0.03 2455730.70360 V 14.66 0.04 2455738.32865 V 14.00 0.02 2455742.86146 V 14.21 ...
... Зорич Владимир Антонович . ... Профессор кафедры Математического анализа механико-математического факультета МГУ. ... Автор 85 математических работ (2012) и университетского учебника по математическому анализу для студентов физико-математических специальностей. ... Зорич В. А., Математический анализ задач естествознания , МЦНМО, М., 2008 . ... В.А.Зорич, Математический анализ задач естествознания. ... В.А.Зорич, Математический анализ (в двух томах: части I и II). ... В.А.Зорич, Математический анализ...
... One of the project objectives was to investigate practical efficiency of some modern iterative methods, including multigrid techniques and domain decomposition methods as well as methods for small compressible materials. ... Hence, the project research initiated because of INTAS financial support contributes in setting up modern computational techniques in tire design. ... Research on efficiency of iterative methods was conducted at the department of Mechanics of Composites about ten years ago. ...
... Aerospace and environmental medicine Automation and Remote Control Optoelectronics, Instrumentation and Data Processing Acoustical Physics St Petersburg Mathematical Journal Algebra and Logic Angiologiia i sosudistaia khirurgiia = Angiology and vascular surgery Anesteziologiya i Reanimatologiya Antibiotiki ... Moscow University Mathematics Bulletin . ... Moscow University Chemistry Bulletin . ... Mathematics - , . ... Physics, Chemistry, Mathematics Nauchno-Tekhnicheskaya Informatsiya. ...
[
Текст
]
Ссылки http://www.geol.msu.ru/vestnik/spisok_vak.pdf -- 350.9 Кб -- 08.04.2016
[
Текст
]
Ссылки http://geol.msu.ru/vestnik/spisok_vak.pdf -- 350.9 Кб -- 08.04.2016 Похожие документы
hpc@cmc . Высокопроизводительные вычисления на ВМК МГУ . Blue Gene/P . Regatta . ... Серия Blue Gene в мире . ... Факультет вычислительной математики и кибернетики МГУ . ... parallel.ru . ... Parallel Computing . ... Некоммерческое программное обеспечение Intel : . ... Часть ссылок и описаний к ним любезно предоставлена администратором сайта кафедры АНИ факультета ВМК МГУ имени М. В. Ломоносова . Факультет ВМК МГУ . ... 2008 2013 Факультет ВМК МГУ имени М. В. Ломоносова . ...
ЛАБОРАТОРИЯ . ... The events surrounding the transfer of power from the legitimate heir and subsequently Emperor Peter III to his wife Catherine as a result of the coup d’Иtat of June, 1762, bring out some of the most interesting ways in which odes could move beyond the panegyric mode into themore dangerous territory of political commentary. ... The problem was particularly acute for those poets who, unwisely, had rushed to write odes in praise of Peter III when he came to power. ...
... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...
[
Текст
]
Ссылки http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/poster_mccmb_2011.pdf -- 225.5 Кб -- 21.07.2011 Похожие документы
... www.net.cmu.edu (Carnegie Mellon University, Pittsburgh, PA - English) - D . ... Washington, DC - English) - A* This site is a general network-troubleshooting utility; it runs BGP, ping, traceroute, and a number of other routing-related utilities. ... www.efrei.fr (Efrei's, Paris - French) - * Options for timeout, TTL, name resolution . ... English) . ... Each one has a link to a network information tool, which will do an nslookup, visual ping, 30-packet ping, or traceroute to it. ...
. Кафедра истории зарубежной литературы . филологического факультета МГУ им. М.В. Ломоносова . Department of History of Foreign Literatures, Lomonosov State University of Moscow (MGU) . Новости и объявления . Кафедра . Преподаватели кафедры . Заседания кафедры . Диссертационный совет . Научное Студенческое Общество . Конференции . Издания кафедры . История кафедры . Учебная деятельность . Общие курсы (бакалавриат) . Спецкурсы и спецсеминары (бакалавриат) . Магистратура . Программы . Правила оформления
... Рейтинг страниц в теме: . Астрокосмические форумы (и их сайты) . ... В списке темы всего страниц: 16 , из них 14 новых (менее 100 дней) и 11 малооцененных (менее 5 оценок) . ... Общая Астрономическая Конференция New! . ... Оценено и сдано в архив! . ... Форумы Авиабазы: Космические новости New! ... Форумы сайта журнала ''НОВОСТИ КОСМОНАВТИКИ'' New! ... Форумы Астронета New! . ... WWW - форум Астрономия сайта ЯАГО 'Меридиан' New! . ... НАЗАД, В СПИСОК КАТЕГОРИЙ (титульная страница AstroTop-100) . ...
... Структура Института . Форум . ... 30 сентября 2009 года . Четвертый международный форум Партнерство государства, бизнеса и гражданского общества при обеспечении информационной безопасности и противодействии терроризму . ... Председатель Оргкомитета форума Помощник Секретаря Совета Безопасности Российской Федерации, директор Института проблем информационной безопасности МГУ имени М. В. Ломоносова В. П. Шерстюк. ... Институт проблем информационной безопасности МГУ имени М. В. Ломоносова. ...
... The mo del is a directed dyadic acyclic graph. ... New vertexes are added one by one. The probability of this addition dep ends on the structure of existed graph. ... 4 (2 ) FIGURE 4: The probabilities of different variants to add a new vertex to the future in the step number 500. pij is the probability to add a new vertex to the outgoing external edges numbers i and j . Similarly, p is the probability to add a new vertex to the incoming external edges numbers and . ...
[
Текст
]
Ссылки http://temporology.bio.msu.ru/EREPORTS/krugly_an-example.pdf -- 690.9 Кб -- 27.02.2014 Похожие документы
Культура и искусство в условиях перехода российской экономики к рыночным отношениям. ... Культура и бизнес: общее и особенное, пути взаимодействия. ... Ахиллесова пята современной российской культуры - культурная политика. ... Бизнес - культуре: модели и технологии управления. ... М., 2006. ... Культура и культурная политика. ... Оганов А. А., Хангельдиева И. Г. Теория культуры. ... Оганов А. А., Хангельдиева И.Г. Мировой опыт многоканального финансирования культуры 0,5 п.л. РАГС - Владимир, 2006. ...
Faculty of Physics of Lomonosov Moscow State University . ... Department of Photonics and Microwave Physics is one of the largest departments of Faculty of Physics of Lomonosov Moscow State University . ... Our department holds annual conference on wave phenomena in nonhomogeneous media, physics and applications of microwaves in May in Moscow suburb. ... Physics of microwaves . ... Department of Photonics and Microwave Physics . Faculty of Physics . Lomonosov Moscow State University . ...