... 1997-2000 ) - (0-117) , .. 2001 . ... a. ppa . ... a (a paa), pa . ... 1999 "" - . ... 1 31 1997 , , 1 1998 , . ... p a pa a apa pa; ! ... a, ap aa a a ppa paa apa a p p p p a paa P. - . ... 5 2000/2001 317 9.00-10.35 12.40-14.15 .. ... p pp apap p p pa. 2. paa ppa ppa · Ppa ppa ap pa a p pap. · paa pa ppa pa ap ppa paa paa pap. · pp pa ppa AREN (pa pp a, R-apa, p p apa). · a pa a pa p p (a pa ppa, ). ... 100 80 60 40 20 0 1997 1998 1999 2000 38 100 80 60 40 20 0 1997 1998 1999 2000 , 250 , . ...
The Laboratory of the Historical Information Science . ... The historical information science laboratory was founded within the structure of the source studies department on 8 December 1995 for the purpose of fulfilling the decision of the academic council of the History Faculty of 4 October 1991 about the transformation of a group for the application of mathematic methods and mainframes in historical research in the laboratory of historical information sciences. ... Senior laboratory assistant (2) . ...
Межфакультетский курс «Математическое моделирование и численное исследование актуальных проблем физики плазмы» (Mathematical modeling and numerical research of the actual problems in the plasma physics) (весенний семестр 2015-2016 уч. г., 24 часа, зачет) Лектор: Козлов Андрей Николаевич, (м.т. 8-915-401-63-92, andrey-n-kozlov@mail.ru ) д.ф.-м.н., профессор кафедры вычислительной механики мех.-мат. факультета, зав. кафедры академик В.А.Левин Программа курса лекций проф. А.Н.Козлова 1. ...
[
Текст
]
Ссылки http://new.mfk.msu.ru/uploads/attachments/attachment_188_1454312707.doc -- 49.5 Кб -- 01.02.2016 Похожие документы
... a) int x = 0; int f ( int a, int b) { return x = a + b; } class A { int x; public : A ( int n = 1) { x = n; } int f() { return ::x = x; } }; class B { int x; public : B ( int n = 2) { x = n; } }; class C: public A, public B { int x; public : int f( int a) { return ::x = x; } void g (); }; ... class X { public: void g () {cout << "g" << endl;} int h (int n) {cout << "f" << endl; return n} }; int main () { int k; const X x; X::g(); k = x.h(5); return 0; } 6.3. ...
[
Текст
]
Ссылки http://al.cs.msu.ru/files/cpp.tasks.2013.pdf -- 754.3 Кб -- 25.01.2014
[
Текст
]
Ссылки http://al.cs.msu.su/files/cpp.tasks.2013.pdf -- 754.3 Кб -- 25.01.2014
[
Текст
]
Ссылки http://al.cmc.msu.ru/files/cpp.tasks.2013.pdf -- 754.3 Кб -- 25.01.2014 Похожие документы
... There are corresponding results showing that the Poincare duals of certain totally ge odesic cycles, which we will call "special cycles", span a definite part (a refined Hodge component) of the cohomology of the locally symmetric spaces of standard arithmetic type associated to the orthogonal groups O(p, q). ... Math. ... KLM3] (with B. Leeb and M. Kapovich) The generalized triangle inequalities in symmetric spaces and buildings with applications to algebra, Memoirs of the AMS, Vol. ...
[
Текст
]
Ссылки http://www.dubrovinlab.msu.ru/files/Alltogether.pdf -- 334.8 Кб -- 15.09.2012
[
Текст
]
Ссылки http://dubrovinlab.msu.ru/files/Alltogether.pdf -- 334.8 Кб -- 15.09.2012 Похожие документы
... Рощин Алексей/ Roshchin Alexei, 2 курс, Public sector of the Russian economy in the post-Soviet period/ Государственный сектор экономики России в пост-советский период. ... Венгеров Максим, 2 курс, Education in Africa. ... Мария Лагузова, 2 курс, The problem of Internet and Social networks in the modern World. ... Красильникова Анастасия, 2 курс, Political technologies at the elections in the 1990s in Russia/ Политтехнологии избирательных кампаний 90-х годов в России. 12.15-13.00 - перерыв 1. ...
... The IV Congress of the socio-political . movement 'Nash Dom - Rossiya' ('Our Home - Russia') . ... of the IV Congress of the NDR .. ... Speech delivered at the IV Congress . of the NDR 'On the socio-economic and political situation . in our country and the tasks of the Movement' .. ... Information at the IV Congress of the NDR . ... of the Movement's program' .. ... Political resolution of the IV Congress of the NDR . ... Adressal of the IV Congress of the NDR . ... Lobby in Russia . ...
hpc@cmc . Высокопроизводительные вычисления на ВМК МГУ . Blue Gene/P . Regatta . ... Серия Blue Gene в мире . ... Факультет вычислительной математики и кибернетики МГУ . ... parallel.ru . ... Parallel Computing . ... Некоммерческое программное обеспечение Intel : . ... Часть ссылок и описаний к ним любезно предоставлена администратором сайта кафедры АНИ факультета ВМК МГУ имени М. В. Ломоносова . Факультет ВМК МГУ . ... 2008 2013 Факультет ВМК МГУ имени М. В. Ломоносова . ...
... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...
[
Текст
]
Ссылки http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/poster_mccmb_2011.pdf -- 225.5 Кб -- 21.07.2011 Похожие документы
Information Security Meeting Schedule Thursday, March 30 12:00 noon Opening and Catered Lunch 1:00 R. Sekar, Stony Brook University - Ongoing Research at Secure Systems Laboratory at Stony Brook University 1:30 Scott Craver, Binghamton University - Information Hiding and Counterdeception 2:00 Sanjay Goel, University at ...
[
Текст
]
Ссылки http://www.suny.msu.ru/ru/ProgrBufMar2006.doc -- 32.5 Кб -- 24.08.2010
[
Текст
]
Ссылки http://suny.msu.ru/ru/ProgrBufMar2006.doc -- 32.5 Кб -- 24.08.2010 Похожие документы
Dapor M., Rau E.I., Sennov R.A. "Experimantal and computational study of the mean energy of electrons backscattered from surface films". ... Wong W.K., Rau E.I., Thong J.T. 'Electron-acoustic and surface electron beam induced voltage signal formation in scaning electron microscopy analysis of semiconductors samples'. ... Rau E.I., Khursheed A., Gostev A.V., Osterberg M. 'Improvements to the design of an electrostatic toroidal backscattered electron spectrometer for the scanning electron microscope'. ...
trendence Graduate Barometer Europe 2011 About the survey About trendence trendence Graduate Barometer Europe is an annual online student survey which allows students to express their opinion on topics re lated to career and education. ... Ulrike Heyne Project Manager trendence Graduate Barometer Europe 2011 About the survey Facts and benefits How does it work? ... If your students take part in the trendence Graduate Barometer, they will receive an exclusive Student Report. ...
[
Текст
]
Ссылки http://studsov.math.msu.su/Sites/studsovet/Uploads/trendence_GBE_2011_-_About_the_survey.docs1.pdf -- 209.6 Кб -- 20.10.2012 Похожие документы
... Показано, что физические условия за фронтами волн являются благоприятными для генерации мягкого рентгеновского излучения, наблюдающегося при солнечных вспышках и при столкновении ветров в двойной системе. ... Астрономия. 1999, номер 1, с.59-62 Москва: Издательство МГУ Абстракт: Обнаружение источника переменного рентгеновского излучения ближайшей к нам двойной звезды типа RS Гончих Псов (Капеллы) дало возможность определить физические условия в нем. ...
... E-mail: Tchytannya@gmail.com Website of the Conference: www.tchytannya.org.ua Mailing address: National University "Law Academy of Ukraine named after Yaroslav Mudriy", Department of the Constitutional Law of Ukraine, organizing committee of The International Science Conference of Young Scientists, Researchers, Postgraduates and Students "Values of modern constitutionalism (V Todyka's readings)" Pushkinska street, 77, Kharkiv, 61024, Ukraine. ...
[
Текст
]
Ссылки http://www.law.msu.ru/bitcache/9af64c1c38133e2400976ad6af22fd1007e46b3e?vid=21924&disposition=attachment&op=download -- 283.0 Кб -- 01.10.2012 Похожие документы
. Маргиналии 2008: периферия культуры и границы текста. Вступительное слово . Гуманитарное знание предлагает традиционное членение предметных сфер, которыми занимаются специалисты, работающие в конкретных областях знаний. При этом целые пласты явлений оказываются маргинальными, попадают на 'ничейную' территорию, находящуюся между - лингвистикой и психологией, философией и историей, искусствоведением и социологией и т. д. Между тем анализ подобных явлений, обращение к пластам еще не осмысленного материала
Economic, industry and corporate trends A report from the Economist Intelligence Unit sponsored by Cisco Systems Foresight 2020 Economic, industry and corporate trends Contents Preface Executive summary Chapter 1: The world economy Chapter 2: Industries Automotive Consumer goods and retailing Energy Financial services Healthcare and pharmaceuticals Manufacturing Public sector Telecoms Chapter 3: The company Appendix I: Survey results 2 3 6 22 24 30 36 43 50 57 62 67 74 86 Appendix II: Methodology for
[
Текст
]
Ссылки http://bc.fdo.msu.ru/Nik_s/WorkFiles/DOC_files/World_shares_foresight_2020.pdf -- 425.8 Кб -- 20.03.2012 Похожие документы
... The linguistic aspects of the model and the properties of the semantic dictionary ensuring the content analysis with compression of the text structure are considered. Our dictionary resources serve an instru- ment for building a multilevel textual semantic structure. ... Reason (A,B), where SemF(A) = SIT or a whole semantic formula; the same for SemF(B). ... Sem(SIT)R . ... Semantic Resources for Textual Content Compression // Fourth International Conference on Meaning-Text Theory (MTT'09). ...
News from the UNESCO Chair on Global Problems Journal 1/2016 Moscow Russian Federation Lomonosov Moscow State University Faculty of Global Processes Dear colleagues, UNESCO Chairholders and members, international scientists, friends! ... When inaugurating the Chair, the Rector of the University Acad. ... The visit of the UNESCO Director General to the Moscow University represents an important milestone for the development of the multifaceted cooperation between UNESCO and the Russian Federation. ...
[
Текст
]
Ссылки http://unesco.fgp.msu.ru/wp-content/uploads/2016/02/Journal-1.2016.pdf -- 712.2 Кб -- 29.02.2016 Похожие документы