Lomonosov Moscow State University FACULTY OF ARTS 2011 ALEXANDER LOBODANOV DEAN OF THE FACULTY OF ARTS WxtЊ vҐЂЂxtzтxс4 g{x YtvтЂрч Ґy TЊрс уxЊx tvvx¶рxw |° ... Since 2003 he has been chairman of the Department of Semiotics and the General Theory of History, founded by him, the first of its kind in Europe. ... Department of Semiotics and the General Theory of Arts The Department of Semiotics and the General Theory of Arts is a theoretical department. ... Galina Zadneprovskaya manages this department. ...
... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...
[
Текст
]
Ссылки http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/poster_mccmb_2011.pdf -- 225.5 Кб -- 21.07.2011 Похожие документы
... Рощин Алексей/ Roshchin Alexei, 2 курс, Public sector of the Russian economy in the post-Soviet period/ Государственный сектор экономики России в пост-советский период. ... Венгеров Максим, 2 курс, Education in Africa. ... Мария Лагузова, 2 курс, The problem of Internet and Social networks in the modern World. ... Красильникова Анастасия, 2 курс, Political technologies at the elections in the 1990s in Russia/ Политтехнологии избирательных кампаний 90-х годов в России. 12.15-13.00 - перерыв 1. ...
... Information for the applicants . ... News . ... The Faculty of Bioengineering and Bioinformatics, Lomonosov Moscow State University was founded in 2002 with the express purpose of training of highly qualified personnel for the universities, research institutes, medical companies and facilities, and pharmaceutical and biotechnology industries. ... Faculty of Bioengineering and Bioinformatics, office 433. ... 2016 Faculty of Bioengineering and Bioinformatics, . Lomonosov Moscow State University . ...
... каталоги . ... Введите данные для поиска . ... Каталоги: 51 . БЕН РАН - Журналы БЕН РАН - Каталог книг и продолжающихся изданий ВГБИЛ - Каталог Книги ВГБИЛ - Каталог Периодика ГПНТБ России - Электронный каталог ГПНТБ России ГПНТБ России - Российский сводный каталог по научно-технической литературе ИНИОН РАН - Электронный каталог с 1991 г. БИК.Финуниверситет - Основной каталог БИК.Финуниверситет - Книги Киб НБ МГУ - Электронный каталог Книг c 1990 г. НБ МГУ - Электронный ...
... 11:00-11:30 Break 11:30-12:00 Lecture 3 Prof . Heinz Oberhammer , Institute of Physical and Theoretical Chemistry , University of Tubingen, Germany Structures and Conformations of Disilacyclohexanes 12:00-12:30 Lecture 4 Prof . Ingvar Arnason , University of Iceland, Iceland Energetics and Potentional Energy Surfaces of Disilacyclohexanes 12:30-13:00 Lecture 5 Prof . Igor Godunov, Chemistry Department , MSU , ...
Thunderstorms and Elementary Particle Acceleration . ... Conference . The first announcement . ... The Thunderstorms and Elementary Particle Acceleration (TEPA-2012) conference is the second one devoted to the studies of the extreme atmospheric effects connected with amplification of electric fields in the lower atmosphere. ... TEPA-2012 conference will be held from July 9 till July 11, 2012, just after the 23rd European Cosmic Ray Symposium also organized by MSU ( http://ecrs2012.sinp.msu.ru ) . ...
... Division of Applied Mathematics, . Faculty of Physics, MSU . ... Prof. A.G. Kushner: "Geometry of Jet Spaces and Applications in Mathematics and Physics" Seminar meeting of the devision of AM 14:00 aud. 4-46 . ... Morozov: "Automation Output Theorems about Conserving the Properties of Mathematical Models" Seminar meeting of the devision of AM 17:00 aud. ... Department of Mathematics, Faculty of Physics, Lomonosov MSU 2014-2016. ...
... Faculty of Physics . ... Research Centers . ... Search Faculties Staff . Education . ... Any division Budget Depatment Center of Computer Physics (CCP) Center of Education Quality Control Center of Hydrophysical Studies Center of Information Systems and Technologies (CIST) Chair of Acoustics Chair of Astrophysics and Stellar Astronomy Chair of Atomic Physics , Plasma Physics , and Microelectronics Chair of Biophysics Chair of Celestial Mechanics, Astrometry, and Gravimetry ...
... Faculty of Physics . ... Divisions Chairs . ... Search Faculties Staff . Education . ... Any division Budget Depatment Center of Computer Physics (CCP) Center of Education Quality Control Center of Hydrophysical Studies Center of Information Systems and Technologies (CIST) Chair of Acoustics Chair of Astrophysics and Stellar Astronomy Chair of Atomic Physics , Plasma Physics , and Microelectronics Chair of Biophysics Chair of Celestial Mechanics, Astrometry, and Gravimetry ...
... Place: A private EE centre (Laboratory for Optimization of Nature Exploitation LONE) and public kindergartens at Pushchino in the Moscow region. Target groups: Pre-school age children (3-6), school children (9-15), kindergarten teachers. ... In the second phase training was provided to all kindergarten teachers who volunteered to participate in the project as well as for 20 school children selected during practical courses, lectures and seminars. ...
... Мы ведем преподавание дисциплины Программирование и решение задач на ЭВМ для первокурсников; сопровождаем компьютерные классы, которые используют в учебной работе различные кафедры факультета , а часть времени выделена для самостоятельной работы студентов, аспирантов и сотрудников ; осуществляем техническое администрирование сети chem.msu.su ; консультируем преподавателей и сотрудников факультета в области вычислительной техники; ...
... О Центре . ... Открытие Центра . ... Технологии Intel . Технологии программирования . ... Технологии Intel в основе учебного процесса . ... подробной технической информации о разработке игр, мультимедийных приложений, решений для совместной работы и финансового ПО; . ... Страница Центра компетенции (ЦК) СО РАН-Intel по высокопроизводительным вычислениям. Репортаж об официальном открытии Центра . ... Зарегистрируйтесь на сайте поддержки продуктов . ... на сайт поддержки. ...
... БИБЛИОТЕКА НИИЯФ МГУ . ... Полный список журналов ELSEVIER и SpringerLink доступных в 2011 году . ... Электронные ресурсы НИИЯФ МГУ . ... Acta Physica Hungarica, New Series, Heavy Ion Physics . ... Applied Physics Letters . ... аннотации . ... Astrophysical Journal, Astrophysical Journal Letters, Astrophysical Journal Supplement series . ... Journal of Physical Chemistry A . ... The European Physical Journal - Applied Physics . ... The European Physical Journal E: Soft Matter and Biological Physics ...
Центр коллективного пользования . МГУ им. М.В. Ломоносова . ... Главная страница . О центре . ... Уже несколько лет в МГУ действует Центр коллективного пользования, объединивший передовые лаборатории естественнонаучных факультетов МГУ, в распоряжении которых имеется самое современное оборудование. ... Центр коллективного пользования МГУ им. М.В. Ломоносова, 2009 . ...
... Alexey D. Neverov . ... Department of Bioengineering and Bioinformatics, Moscow State University. State Scientific Center GosNIIGenetika. ... EDAS human . EDAS mouse . EDAS dog (not availible now) . EDAS rat (not availible now) . To navigate this site please install the latest version of Macromedia Flash Player for Windows or for Linux . If you do not wish to install Flash you could use text pages with less functionality. ...
... Новости . Объявления . Контакты . ... Расписание . О кафедре . ... на кафедру . ... ВМК . МГУ . ... СМУ ВМК . Расписание экзаменов 415 группы. ... Кафедра системного анализа ВМК МГУ создана в 1992 году. Организатор и заведующий кафедрой - лауреат Ленинской премии, заслуженный профессор МГУ, академик РАН Александр Борисович Куржанский . ...
... Кафедра иммунологии Биологического факультета . ... Страница памяти А.А. Ярилина . ... Опубликовано 16/04/2011 20/04/2011 Рубрики immunology-today Добавить комментарий к записи Лекции Тома Хамильтона 21 и 22 апреля . ... Опубликовано 02/12/2010 29/06/2011 Рубрики immunology-today Добавить комментарий к записи Как Т-клетки узнают антиген . ... Опубликовано 20/09/2010 25/09/2010 Рубрики immunology-today Добавить комментарий к записи Научный семинар в рамках курса ?Актуальные проблемы иммунологии? ...
... The Informativeness of Coherence Analysis in EEG Studies A. P. Kulaichev UDC 612.821.6 Translated from Zhurnal Vysshei Nervnoi Deyatel'nosti imeni I. P. Pavlova, Vol. ... KEY WORDS: coherence, spectral analysis, EEG non-stationarity, amplitude modulation. ... In particular, the two fundamental differences between EEG signals and most other physical signals are not considered: a) fundamental non-stationarity; b) amplitude modulation at all frequency ranges. ... Coherence in technical addenda. ...