... Coordination of economic policies and convergence of economic performance are fundamental to the integration of national economies in the Community. ... When U.S. President Barack Obama enters his White House meeting with Israeli Prime Minister Benjamin Netanyahu on March 5 -- angling to dissuade Israel from attacking Iran's nuclear facilities -- there will be one seemingly mundane issue on his mind that he may be too uncomfortable to share with his guest: gasoline prices. ... 2004. ...

Еще в разделе: (Показать все результаты (>2) - practice.msu.ru/ )

... Structural Analysis of Disk Galaxies of the NGC 524 Group M. A. Il'ina and O. K. Sil'chenko * Sternberg Astronomical Institute, Lomonosov Moscow State University, Moscow, Russia Received February 24, 2012; in final form, March 2, 2012 Abstract--Members of the NGC 524 group of galaxies are studied using data obtained on the 6m telescope of the Special Astrophysical Observatory of the Russian Academy of Sciences, with the SCORPIO reducer in an imaging mode. ... NGC 502. ... NGC 524. ... Rev. Astron. ...

Еще в разделе: (Показать все результаты (>49) - sn.sai.msu.ru/ )

• http://sn.sai.msu.ru/~sil/preprints/n80eng.pdf
• http://sn.sai.msu.ru/~sil/preprints/62782.ps
• http://sn.sai.msu.ru/~sil/preprints/expsauron.pdf

... Научно-исследовательская работа Совета женщин МГУ. ... М.:Изд-во МГУ, 2000). ... ХХ International Conference 'Mathematics. ... МГУ (2012). ... V International conference Russian association of women's history researchers. ... 4 IUPAP International conference on Women in Physics. ... International conference 'From the women's issue to gender studies'. ... 3 IUPAP International conference on women in physics. ... 2 IUPAP International Conference on Women in Physics. ... Совет женщин МГУ, Москва (2000)...

Еще в разделе: (Показать все результаты (>3) - www.womenmsu.msu.ru/ )

ЦЕНТР ТРАНСФЕРА ТЕХНОЛОГИЙ МГУ имени М.В.Ломоносова . ... Центр трансфера технологий МГУ совместно с кафедрой "Экономики инноваций" экономического факультета МГУ проводит цикл лекций "Коммерциализация результатов интеллектуальной деятельности и основы интеллектуальной собственности" (всего 5 лекций). ... Положение по организации работы в области создания, правовой охраны и использования результатов интеллектуальной деятельности в МГУ имени М.В.Ломоносова, утвержденное ректором МГУ 16 марта 2012 года. ...

Еще в разделе: (Показать все результаты (>3) - ctt.msu.ru/ )

THE FIRST JAPAN-RUSSIA MEDICAL FORUM PROGRAM Date: December 10, 2012 Venue : Intellectual Center - Fundamental Library of Lomonosov Moscow State University Bld.27, Lomonosovskiy prospect, Moscow , 119991, Russia Organizers: Lomonosov Moscow State University Tohoku University Supported by Embassy of ...

Еще в разделе: (Показать все результаты (>26) - fbm.msu.ru/ )

• Факультет фундаментальной медицины МГУ

Supernova 2003ei in UGC 10402 . This page is devoted to information on Supernova 2003ei in UGC 10402 Basic information on this SN, including the last reported brightness, on this Supernova can be found on the main page . Information on the original web pages for many of these images can be found on the updates and links web pages. Yet one more discovery by LOTOSS . ... Icon generated from the discovery image. ... SNWeb has a 2003ei page . ... 2003/05/19.4 . ... J. Nicolas image . ...

Еще в разделе: (Показать все результаты (>21) - www.rochesterastronomy.org/ )

• Supernova 2005cs in M51
• THE BRIGHT SUPERNOVA 1991T IN NGC 4527; AN AMATEURS PRESPECTIVE

... MAX, MAX], MAX = 3'812'798'742'493. . ... MEMCAP - (read only) CSP - Control Stack Pointer - CSPL - CSP Low ­ CSP - CSP High ­ DSP - Data Stack Pointer - DSPL - DSP Low ­ DSP - DSP High ­ EXC - Exception ­ (0 ­ ) PC - Program Counter ­ STATUS - . ... EXC==-3) && (STATUS[IE]==1))) { pushcs(STATUS); // STATUS STATUS[IE]=0; // pushcs(PC); // PC PC = m(IVBASE + EXC); // EXC = 0; } else // { if (ICL == 1) // IC locked, IC ICL=0; else // { IC = m(PC); PC = PC+3; } } // IC PC execute; . ... STATUS. ...

Еще в разделе: (Показать все результаты (>2) - ternarycomp.cmc.msu.ru/ )

... Institute of Nuclear Physics, . ... I have been directly involved in theoretical and phenomenological analysis -- within the D? collaboration -- devoted to a search for single top quark production in the electroweak processes. ... 1] B. Abbott et al. ... D0 Collaboration], ``Inclusive jet production in p anti-p collisions,'' hep-ex/0011036. ... D0 Collaboration], ``Search for electroweak production of single top quarks in p anti-p collisions,'' hep-ex/0008024. ... Phys.Rev.Lett. ...

Еще в разделе: (Показать все результаты (>9) - top.sinp.msu.ru/ )

... Главная Новости Сети Рукопись История Конференции Журналы Ссылки О проекте . ... Journal of Personality and Social Psychology - - Журнал психологии личности и социальной психологии . The British Journal of Social Psychology . Британский журнал социальной психологии". ... Social Forces . Social Forces is a renowned journal of social research highlighting sociological inquiry but also exploring realms shared with social psychology, anthropology, political science, history, and economics. ...

Еще в разделе: (Показать все результаты (>77) - psyberlink.flogiston.ru/ )

• Библиография по экономической психологии
• Serge Moscovici. Social Representations Theory and Social Constructionism

О кафедре . ... Иванов А.О., Тужилин А.А. Разветвленные геодезические. ... Иванов А.О., Тужилин А.А. Лекции по классической дифференциальной геометрии. ... Иванов А.О., Ильютко Д.П., Носовский Г.В., Тужилин А.А., Фоменко А.Т. Компьютерная геометрия: практикум. ... Иванов А.О., Тужилин А.А. О деформации многообразия, уменьшающей объем с максимальной скоростью, и ее приложении в теории гравитации. ... Иванов А.О., Тужилин А.А. Конспекты лекций по дифференциальной геометрии и топологии. ...

Еще в разделе: (Показать все результаты (>32) - dfgm.math.msu.su/ )

• Носовский Г.В. / Кафедра Дифференциальной геометрии и приложений /
• Иванов А.О. / Кафедра Дифференциальной геометрии и приложений /
• Международные и внутрироссийские связи кафедры / Кафедра Дифференциальной

The Lomonosov Moscow State University Faculty of Educational Studies The MSU FES offers various educational programs: 1. Master program "Education Management"; 2. ... Qualification training programs "School Teacher" and "Higher School Teacher". The FES was founded in 1997 with the main goal to teach those students of the MSU faculties who wished to receive the qualification of Secondary and Higher School teacher & lecturer in addition to their basic speciality. ...

Еще в разделе: (Показать все результаты (>3) - fpo.msu.ru/ )

... UHECR SINP MSU . ... TUS . JEM-EUSO . mini-EUSO (UV atmosphere) . News . ... Lab's news . ... JEM-EUSO Extreme Universe Space Observatory on the Japanese Experiment Module (JEM) of the International Space Station . ... mini-EUSO and EUSO-SPB Progress Meeting . ... The 18th International JEM EUSO Collaboration Meeting . The 18th International JEM EUSO Collaboration Meeting held in Stockholm from 7 to 11 December 2015. ... 18th International JEM EUSO Collaboration Meeting . ...

Еще в разделе: (Показать все результаты (>18) - uhecr.sinp.msu.ru/ )

• JEM-EUSO
• Tests of the PDM digital electronics prototype for K-EUSO, Paris, 2015
• UV atmosphere (mini-EUSO) experiment onboard Russian segment of the ISS

... This article caused a most lively interest from the readers, and received more than a hundred responses, which contained various versions of construction methods of the Sri Yantra. ... In this way he revealed a good correspondence between the concentric levels built by him in this relationship of the three Sri Yantra and the orbits of the planets of the solar system (Fig. 10, shows the first two out of three stars examined by him) with a divergence from the real diameters of orbits of about 1.5%. ...

Еще в разделе: (Показать все результаты (>21) - www.protein.bio.msu.ru/ )

• http://www.protein.bio.msu.ru/~akula/JourVND6_09KulaichevLO.pdf
• http://www.protein.bio.msu.ru/~akula/coherence.pdf

Козлов А.Н. Кинетика ионизации и рекомбинации в канале плазменного ускорителя. Известия РАН, механика жидкости и газа. 2000, ? ... Kozlov A.N. Modeling of rotating flows in the plasma accelerator channel with longitudinal magnetic field. ... Kozlov A.N. Plasma flow peculiarities in accelerator channel with longitudinal magnetic field. ... Kozlov A.N., Zaborov A.M. Formation of the current attachments in plasma accelerator channel under influence of the longitudinal magnetic field. ...

Еще в разделе: (Показать все результаты (>8) - compmech.math.msu.su/ )

• Список публикаций - Е. Б. Кудашев - Кафедра вычислительной механики

... Конкурс У.М.Н.И.К. Объявления . ... Лучший молодой ученый года иљ . ... Конкурс научных работ молодых ученых МГУ (?Конкурс СМУ 2016?) Объявлен 40-й Конкурс научных работ молодых ученых МГУ, проводимый СМУ МГУ.љ ... 20 октября 2016 г. состоится полуфинальная конференция У.М.Н.И.К. 20 октября 2016 г. (ориентировочная дата) на Физическом факультете МГУ љ состоится полуфинальная конференция на получение премии поддержки молодых ученых У.М.Н.И.К. љ 20 октября 2016 г. состоится полуфинальный .. ...

Еще в разделе: (Показать все результаты (>4) - smu.physics.msu.ru/ )

... if (B1) { S1; } if (B1) { S1; } if (B2) { S2; } - - ...exp... int x = 1; if (x == 1) { std::cout << "Okay" << std::endl; } else { std::cout << "Error" << std::endl; } -- ­ int strlen(const char* p) { int len = 0; do { ++len; } while (*p++); return len; } «», «bbb» -- , : · ­ , , · ­ , , · ­ , · ­ . ... 1977 ­ LTL, · , 1981 ­ (CTL), · , , 1981 , , 1982 ­ model checking ( ), · , 1986 ­ model checking ( ), · , 1989 ­ SPIN. ... The Spin Model Checker: Primer and Reference Manual, Addison Wesley, 2003. ...

Еще в разделе: (Показать все результаты (>2) - savenkov.lvk.cs.msu.su/ )

... Заведующий лабораторией, доцент, к.х.н., Microsoft Certified Trainer, Microsoft Certified Systems Engineer+Internet. ... В лаборатории с 1983 г. Помимо программно-технического обеспечения проводит занятия со студентами и является tech-admin'ом сети chem.msu.su . ... Старший преподаватель, Microsoft Office Specialist. ... Младший научный сотрудник, Microsoft Office Specialist. ... Microsoft Office Specialist. с 2006 года проводит семинарские и практические занятия со студентами 1-го курса. ...

Еще в разделе: (Показать все результаты (>6) - us.chem.msu.su/ )

Monday, July 18th, 2011 . ... You are currently browsing the Лаборатория лазерной интерферометрии blog archives for July, 2011. О лаборатории . ... Наши публикации . Публикации до 2008 . ... Публикации за 2009 . Публикации за 2010 . Публикации за 2011 . Публикации за 2012 . ... January 2013 . ... June 2012 . ... January 2012 . ... July 2011 . June 2011 . ... January 2011 . ... July 2010 . June 2010 . ... Лаборатория лазерной интерферометрии is proudly powered by WordPress . ...

Еще в разделе: (Показать все результаты (>2) - geo.sai.msu.ru/ )

• Uncategorized Лаборатория лазерной интерферометрии

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>5) - mouse.genebee.msu.ru/ )

Вы посетили: conf_engl.html . ... International Algebraic Conference dedicated to 70th birthday of professor A.V. Mikhalev, Russia, Moscow, November 2010 . ... International Algebraic Conference dedicated to the 100-year anniversary of professor A.G. Kurosh, Russia, Moscow, May 2008 . ... 2nd International Conferences on Matrix Methods and Operator Equations, Russia, Moscow, July 2007 . ... staff/guterman/conf_engl.html.txt Последние изменения: 13.02.2013 11:26 (внешнее изменение) | ...

Еще в разделе: (Показать все результаты (>22) - halgebra.math.msu.su/ )

• staff:guterman:activ_rus.html | Кафедра высшей алгебры
• staff:guterman:conf_rus.html | Кафедра высшей алгебры
• staff:guterman:int_engl.html | Кафедра высшей алгебры