. Евгений Вареник, 28 февраля 2006 . Схема Горнера вычисления значения полинома в точке. Доказательство ее оптимальности в худшем случае по числу операций "сложение" и "умножение" среди алгоритмов, использующих только эти операции. Материалы к докладу: . E.M. Reingold and A.I. Stokes, Simple proofs of lower bounds for polynomial evaluation, in: R.E. Miller and J.W. Thatcher, Eds., Complexity of Computer Computations (Plenum, New York, 1972) 21--29.
... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...
[
Текст
]
Ссылки http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/poster_mccmb_2011.pdf -- 225.5 Кб -- 21.07.2011 Похожие документы
... Елена Фоменко (2 курс). ... Руководитель В. И. Буник, отдел биокинетики НИИ ФХБ им. А.Н.Белозерского МГУ. ... Руководитель А.Г. Евстафьева, отдел химии и биохимии нуклеопротеидов НИИ ФХБ им. А.Н. Белозерского МГУ. ... Руководитель Н.В. Чичкова, лаборатория молекулярной биологии гена отдела химии и биохимии нуклеопротеидов НИИ ФХБ им. А.Н. Белозерского МГУ. ... Руководитель А.Г. Евстафьева, лаборатория молекулярной биологии гена отдела химии и биохимии нуклеопротеидов НИИ ФХБ им. А.Н. Белозерского...
... GhostView/GhostScript --- это программа для просмотра и печатания файлов в формате PostScript (PS). ... На диске содержатся: RusTeX ( TeX для DOS/Windows --- дистрибутив RusTeX и развернутый и работающий с диска RusTeX ); MikTeX ( TeX для Windows --- дистрибутив miktex и файлы для его руссификации); fpTeX ( TeX для Windows --- дистрибутив fpTeX, файлы для его руссификации и развернутый и работающий с диска руссифицированный fpTeX); WinEdt (оконный редактор с кнопочками для...
... This article caused a most lively interest from the readers, and received more than a hundred responses, which contained various versions of construction methods of the Sri Yantra. ... In this way he revealed a good correspondence between the concentric levels built by him in this relationship of the three Sri Yantra and the orbits of the planets of the solar system (Fig. 10, shows the first two out of three stars examined by him) with a divergence from the real diameters of orbits of about 1.5%. ...
[
Текст
]
Ссылки http://www.protein.bio.msu.ru/~akula/Kulaichev%20Addition.pdf -- 75.3 Кб -- 29.10.2013 Похожие документы
... Sov.Phys.-Plasma Phys.) 1978.V.4. ... Timofeev I.B., Bychkov V.L. Influence of ionizing processes on the lifetime of plasma ball in air. ... Bychkov V.L. Database on ball Lightning for PC. ... Bychkov V.L., Bychkov A.V., Stadnik S.A. Polymer Fire Balls in Discharge Plasma. ... Emelin S.E., Bychkov V.L., Astafiev A.M., Kovshik A.P., Pirozerski A.L. Role of discharge products throttling for generation of ball lightning with a condensed core from a high pressure vapor - gas phase Proc. 11-th Intern. ...
... Abstract A Uniform Resource Identifier (URI) is a compact string of characters for identifying an abstract or physical resource. ... This document defines a grammar that is a superset of all valid URI, such that an implementation can parse the common components of a URI reference without knowing the scheme-specific requirements of every possible identifier type. ... URI-reference = [ absoluteURI | ... Otherwise, the reference URI's scheme is inherited from the base URI's scheme component. ...
На правах рукописи Малькова Валентина Валерьевна УСТОЙЧИВЫЕ СРАВНЕНИЯ КАК СРЕДСТВО ВЫЯВЛЕНИЯ АССОЦИАТИВНОГО ПОТЕНЦИАЛА РУССКИХ И НЕМЕЦКИХ СЛОВ Специальность 10.02.20. ... Полностью эквивалентные в плане ассоциативного потенциала слова-эталоны русских и немецких устойчивых сравнений составили всего 10% (отшельник/ der Einsiedler - русск. жить как отшельник (в значении «жить в одиночестве, в отречении»); нем. leben wie ein Einsiedler (букв. жить как отшельник (с тем же значением). ...
... CELL BIOPHYSICS Application of a Photosystem II Model for Analysis of Fluorescence Induction Curves in the 100 ns to 10 s Time Domain after Excitation with a Saturating Light Pulse N. E. Belyaevaa, V. Z. Pashchenkoa, G. Rengerb, G. Yu. ... In the case of weak measuring light, the steady-state level of fluorescence induction curve (Fig. ... The model of PSII predicted that, upon long (10 s) exposure to weak measuring light, the states with open RCs are being populated (Fig. 4, curves 3, 5 QA). ......
... The data on UV glow of the atmosphere obtained in operation of one pixel of the TUS detector on board the Moscow State University "Universitetsky-Tatiana" satellite was taken into account in design of the updated TUS detector. ... The main feature of the design is use of MEMS technology scanning mirror controlled by the TUS computer, analyzing the recorded EAS data and directing the laser to the atmosphere spot, where back scattered Cherenkov light came from. ... Monitoring of UV intensity on-route....
[
Текст
]
Ссылки http://cosrad.sinp.msu.ru/experiments/tus/doc/HO2COSPAR2006.pdf -- 237.2 Кб -- 19.03.2008 Похожие документы
... Alternative core new atoms (%) . ... An alignment of a set of structures is a set of positions , to each position some atoms from different structures correspond. ... Geometrical core of a set of structures is a subset of alignment positions those atoms are disposed similarly in all structures. ... For any two positions included into geometrical core, the distances between CA atoms of those positions in all structures may differ not more than the value of the parameter "Distance spreading". ...
Координатор семинара : академик РАН и Academia Europaea Алексей Ремович Хохлов . ... Заседания семинара проводятся в Конференц-зале Института элементоорганических соединений им. А.Н. Несмеянова РАН ( ИНЭОС РАН , г. Москва, ул. Вавилова, 28). ... Скачать объявление о семинаре . ... Б.М. Графов (Интститут физической химии и электрохимии имени А.Н. Фрумкина РАН, Москва) . ... После доклада предполагается обсуждение целесообразности организации Общемосковского семинара по электрохимии. ...
... MOIP (Moscow Society of Naturalists) is a unique social phenomenon in Russia?s life. ... Great scientists and thinkers such as academicians V.I. Vernadskiy and N.D. Zelinskiy presumed that MOIP acted in Moscow as the Academy of Sciences up to the Saint-Petersburg (Russian) Academy moving to the capital in the thirties of 20 th century. In the course of all these years, the Moscow Society of Naturalists united and coordinates almost all scientific potencies in the sphere of natural science. ...
... Архив новостей . ... После летнего перерыва возобновил свою работу научный семинар лаборатории термохимии. 16 сентября было проведено заседание, на котором м.н.с. Овчинникова Н.С. и асп. 3-го г/о Самохвалов П.С. сделали доклады об участии в конференциях "International Conference on Coherent and Nonlinear Optics and International Conference on Lasers, Applications, and Technologies (2010)" (Казань, Россия) и " International Workshop "Nanocarbon Photonics and Optoelectronics (2010) " (Коли, Финляндия)...
Faculty of Physics of Lomonosov Moscow State University . ... Department of Photonics and Microwave Physics is one of the largest departments of Faculty of Physics of Lomonosov Moscow State University . ... Our department holds annual conference on wave phenomena in nonhomogeneous media, physics and applications of microwaves in May in Moscow suburb. ... Physics of microwaves . ... Department of Photonics and Microwave Physics . Faculty of Physics . Lomonosov Moscow State University . ...
Studying at MU Programs and degrees . ... Moscow State University provides a wide range educational services and educational programmes. ... International students are offered Bachelour (4 years full time) and Master programmes (2 years full time). A number of our faculties train both domestic and international students according to Bachelour and Master programmes with granting Bachelour and Master diplomas. ... Please, contact International Students Office for information on the topics offered. ...
... MSU Chamber Orchestra . ... Chamber Orchestra of Moscow State University was born in 1967. ... It was originally formed as a chamber orchestra at the School of Mathematics and Mechanics but soon (since September 1967) transformed into a Chamber Orchestra of the Moscow State University. ... The Chamber Orchestra of Moscow State University won the first prizes in the 1-st and 2-nd All-Union festivals of non-professional arts. ... Moscow State University does not have its own School of Music. ...
Experimental Study of the Acoustic Field Generated by a 50 MeV Electron Beam in Water V. B. Bychkov1, V. S. Demidov2, E. V. Demidova2, A. N. Ermakov3, O. D. Ershova3, B. S. Ishkhanov3, V. P. Maslyany1, A. Yu. ... At a two-dimensional diagram (distance-time) two signal tracks were observed from two sound sources: a cylindrical acoustic antenna generated by the electron beam, and an area of the beam entrance cap which divides the water medium from the air. ... Fig. ... Arrows mark the beam spill time. ...
[
Текст
]
Ссылки http://antares.sinp.msu.ru/docs/Ershova%20-%20Acoustic%20field%20eng.pdf -- 432.1 Кб -- 16.12.2013 Похожие документы