... Department of History of Foreign Literatures, Lomonosov State University of Moscow (MGU) . About the department . ... Department history . ... About the department / Lectors . ... Chairman, Ph.D., Professor . ... Ph.D. , Associate-Professorљ . ... Ph.D. , Professor . Aleksandra Yuryevna Zinovyeva . ... Ph.D. ,љSenior Researcher . ... Ph.D. , Researcher . ... Ph.D. , Assistant-Professor . ... Olga Yuryevna Panova . ... Irina Yuryevna Popova . ...
О КАФЕДРЕ . ... М., 2002 г., с. 100. ... М., 2002 г., с. 100-101. ... Материалы шестой международной конференции "К созданию общей теории нефтегазоносности недр" кн.2, Москва, ГЕОС, 2002, с. 154-156. ... Proceedings of the international conferens "The Earth's thermal field and related research methods". Moscow, 2002, p. 27-29. ... Petrunin G.I., Popov V.G. Hyper thermal analysis of features of the gear phonon heat transfer in solid solutions of plagioclase. ... Moscow, 2002, p. 196-199. ...
... Публикации . ... 1, 012506 DOI . ... 1, 012509 DOI . ... 1, 103598 DOI . ... Edge field emission of large-area single layer graphene Kleshch V.I., Bandurin D.A., Orekhov A.S., Purcell S.T., Obraztsov A.N. Applied Surface Science, Elsevier BV (Netherlands) DOI . ... Graphene Formation on Surfaces of Single Crystal Metals Shvets P.V., Soon J.M., Verger A., Obraztsov A.N Journal of Nanoelectronics and Optoelectronics, American Scientific Publishers (United States) DOI . ... Материалы, ? ...
... The Semantic Dictionary RUSLAN-1, the last version being Russian-to-English direction, is a tool for semantic and informational analysis of any coherent Russian text. The rich semantic information contained in the dictionary makes possible local, within one phrase, semantic interpretation as well as semantic analysis of coherent texts. ... Text understanding is very closely related to information analysis (Leontyeva 2000). ... We therefore call it "relative understanding". ...
... Кафедра Автоматизации Систем Вычислительных Комплексов . О кафедре . ... Кафедра автоматизации систем вычислительных комплексов (АСВК) была создана в 1970 году в составе факультета ВМК. ... Свою профессиональную подготовку студенты и аспиранты получают в рамках научно-исследовательских семинаров, а также в рамках практических разработок, которые ведутся на кафедре и в лабораториях, возглавляемых профессорами и доцентами кафедры. ... РАН Королева Л.Н.. ...
... E-mail: Tchytannya@gmail.com Website of the Conference: www.tchytannya.org.ua Mailing address: National University "Law Academy of Ukraine named after Yaroslav Mudriy", Department of the Constitutional Law of Ukraine, organizing committee of The International Science Conference of Young Scientists, Researchers, Postgraduates and Students "Values of modern constitutionalism (V Todyka's readings)" Pushkinska street, 77, Kharkiv, 61024, Ukraine. ...
[
Текст
]
Ссылки http://www.law.msu.ru/bitcache/9af64c1c38133e2400976ad6af22fd1007e46b3e?vid=21924&disposition=attachment&op=download -- 283.0 Кб -- 01.10.2012 Похожие документы
... Кафедра системного анализа ВМК МГУ . ... О кафедре . ... на кафедру . ... ВМК . МГУ . ... СМУ ВМК . ... Alexandr Borisovich Kurzhanski) . In Russian . ... Kurzhanski was Elected Associate Member of USSR Academy of Sciences (now changed to Russian Academy of Sciences) in 1981 and Full Member in 1990. He is the Chairman of the Russian National Committee on Automatic Control (the IFAC NMO). ... Chairman of Russian National Committee of Automatic Control. ... 4 (8). pp. 100-118. (in russian). ...
О кафедре . ... Е.А. Кудрявцева неоднократно участвовала в Международных конференциях: . 07/1995 International Union of Geodesy and Geophysics XXI, General Assembly (Boulder, Colorado), invited talk . 01/1998 International Conference in honour of I.Petrovskij (Moscow, Russia), invited talk . 09/1998 International Conference in honour of Lev Pontriagin (Moscow, Russia), invited talk . ... 10/2000 International Conference on Low-dimensional Topology (Oberwolfach, Germany), invited talk . ...
... This sp ectral distribution is defined b oth by the energy distribution in the target star's sp ectrum and by the sp ectral resp onse of the detector, i.e. by the central wavelength 0 and the effective sp ectral bandwidth . ... On the right: The collection of the MASS sp ectral resp onse curves. ... Table 1: Integral characteristics of the resp onse curves of the MASS devices. 0 -- central wavelength, ef f -- effective wavelength for A0 V stars, -- effective bandwidth (integral under the curve). ...
[
Текст
]
Ссылки http://curl.sai.msu.ru/mass/download/doc/mass_spectral_band_eng.pdf -- 303.9 Кб -- 15.12.2006 Похожие документы
... В.Е.Юрасова, Современные теории катодного распыления и микрорельеф распыляемой поверхности металла, ЖТФ, 1958, 28, ?9, 1966-1970. ... V.I.Shulga, I.G.Bunin, V.E.Yurasova, V.V.Andreev, B.M.Mamaev, Influence of surface semichannels on ion scattering by crystals, Phys. Lett., ... Рентгеновские, синхротронные и нейтронные исследования, 2000, ? ... Особенности распыления сплавов Ni-Pd с разным содержанием компонент, Поверхность - рентгеновские, синхротронные и нейтронные исследования, 2006, ?7, 13- 17. ...
Network Working Group T. Berners-Lee Request for Comments: 1945 MIT/LCS Category: Informational R. Fielding UC Irvine H. Frystyk MIT/LCS May 1996 Hypertext Transfer Protocol -- HTTP/1.0 Status of This Memo This memo provides information for the Internet community. This memo does not specify an Internet standard of any kind. Distribution of this memo is unlimited. IESG Note: The IESG has concerns about this protocol, and expects this document to be replaced relatively soon by a standards track document.
... Любимая обувь валерия кипелова . Пристрой детской обуви . ... Благодаря инновационной Технологии All-Day-Effect Воск SALTON обеспечивает эффективную защиту обуви из гладкой кожи от негативного воздействия влаги, снега и грязи в течение всего дня даже в самую сырую погоду. Гелевые подушечки под пятку SALTON Lady обеспечивают комфортное ношение любой обуви. ... Тогда обратите внимание на Salton воск для обуви с норковым маслом в банке нейтральный 75мл. ... Centro оренбург каталог обуви . ...
... Voronin А. Каrmanov D. Savin А. Electronic engineer: . ... Engineer ? ... Electrical design of microprocessor systems, creating software for control and monitoring earth and satellite stations. ... Programming, electrical and layout design of test equipment for testing the silicon matrix for experiment ATIC (Advanced Thin Ionization Calorimeter), creating software for calibration. Electrical design of readout electronics, creating software for collecting and analysis data for experiment NUCLEON . ...
... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...
[
Текст
]
Ссылки http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/poster_mccmb_2011.pdf -- 225.5 Кб -- 21.07.2011 Похожие документы
... An extended set of observables of the nuclear quasi-free (p, d + ) reaction including the triple differential cross-section for coincidence measurements, its analyzing power in case of polarized proton beams and, also, the parameters of the polarization of the excited recoil nucleus and the produced deuteron are considered in the framework of the distorted-wave impulse approximation using the reaction 16 O(p, d + )15 N at a proton energy of 650 MeV as an example. ...
[
Текст
]
Ссылки http://np-chair.sinp.msu.ru/download/epja100510-offprints.pdf -- 426.2 Кб -- 18.03.2015 Похожие документы
... 290 ). 290--320 ), (, 320--400 ) (400--700 ). ... 38 Biophysics (or biological physics) is an interdisciplinary science studing physical and physico-chemical mechanisms of biological processes. ... Biophysics Department of Biological Faculty, Lomonosov Moscow State University, was founded by Prof. Boris N. Tarusov in 1953. ... Biophysics Department of Biological Faculty of MSU provides top-class qualification to young scientists for their work in the field of fundamental and applied biophysics. ...