Please enter the lightcurve file name and period search parameters: . Lightcurve file: . ... Apply the Heliocentric correction and convert all dates to Terrestrial Time (TT)? ... Phase range for plots: -0.5 to 1.0 0.0 to 2.0 0.0 to 1.0 . ... Also, the Heliocentric correction cannot be applied to such lightcurves. ... Two period search methods are currently implemented. ... This period search service is also available at the mirror sites: Mirror 1 , Mirror 2 , Mirror 3 , Mirror 4 . ...
... Мы ведем преподавание дисциплины Программирование и решение задач на ЭВМ для первокурсников; сопровождаем компьютерные классы, которые используют в учебной работе различные кафедры факультета , а часть времени выделена для самостоятельной работы студентов, аспирантов и сотрудников ; осуществляем техническое администрирование сети chem.msu.su ; консультируем преподавателей и сотрудников факультета в области вычислительной техники; ...
This domain may be for sale - этот домен возможно продается . ... The gathered information about your visits to this and other websites are used by these third party companies in order to provide advertisements about goods and services of interest to you. ... If you would like more information about this practice and to know your choices about not having this information used by these companies, click here . ...
... Bashindzhagyan G . ... Panasyuk M . ... Proc.26th ICRC, Salt Lake City , 1999, v.5, p.132-135. Bashindzhagyan G.L., Samsonov G.A., Khein L.A., Panasyuk M.I., . Voronin A.G., Zatsepin V.I., ATIC Collab .. The Advanced Thin Ionization Calorimeter (ATIC) for Studies of High . ... Proc. 26th ICRC, Salt Lake City , 1999, v.5, p.9-12. ... Silicon Matrix Detector for ATIC . ... Proc. 26th ICRC, Salt Lake City , 1999, v.5, p.453-456. ... Advanced Thin Ionization Calorimeter (ATIC) .- ...
... Квантовая теория . ... КВАНТОВАЯ ТЕОРИЯ ПОЛЯ [7-й-8-й семестры] (проф. СЛАВНОВ Д.А.) . ... СОВРЕМЕННЫЕ ТЕОРЕТИЧЕСКИЕ ПРОБЛЕМЫ ФИЗИКИ ВЫСОКИХ ЭНЕРГИЙ [10-й семестр] (с.н.с. САМОХИН А.П.) . ... проф. СЛАВНОВ Д.А. Квантовая теория поля описывает фундаментальные законы современной физики. ... Квантовая теория поля является теоретической основой физики высоких энергий и физики элементарных частиц. ... Квантовая теория поля и физика фундаментальных взаимодействий. ... Введение в квантовую теорию поля. ...
... Кафедра системного анализа ВМК МГУ . ... О кафедре . ... на кафедру . ... ВМК . МГУ . ... СМУ ВМК . ... Alexandr Borisovich Kurzhanski) . In Russian . ... Kurzhanski was Elected Associate Member of USSR Academy of Sciences (now changed to Russian Academy of Sciences) in 1981 and Full Member in 1990. He is the Chairman of the Russian National Committee on Automatic Control (the IFAC NMO). ... Chairman of Russian National Committee of Automatic Control. ... 4 (8). pp. 100-118. (in russian). ...
... О кафедре . Кафедра суперкомпьютеров и квантовой информатики . ... Кафедра проводит обучение по образовательной программе шестилетней интегрированной подготовки высококвалифицированных специалистов с последовательным освоением образовательной программы бакалавриата (4 года) по профилю ?Системное программирование и компьютерные науки? и образовательной программы магистратуры (2 года) по двум магистерским программам: ?Суперкомпьютерные системы и приложения? и ?Квантовая информатика?. ... ИПМ РАН . ...
... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...
[
Текст
]
Ссылки http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/poster_mccmb_2011.pdf -- 225.5 Кб -- 21.07.2011 Похожие документы
Economic, industry and corporate trends A report from the Economist Intelligence Unit sponsored by Cisco Systems Foresight 2020 Economic, industry and corporate trends Contents Preface Executive summary Chapter 1: The world economy Chapter 2: Industries Automotive Consumer goods and retailing Energy Financial services Healthcare and pharmaceuticals Manufacturing Public sector Telecoms Chapter 3: The company Appendix I: Survey results 2 3 6 22 24 30 36 43 50 57 62 67 74 86 Appendix II: Methodology for
[
Текст
]
Ссылки http://bc.fdo.msu.ru/Nik_s/WorkFiles/DOC_files/World_shares_foresight_2020.pdf -- 425.8 Кб -- 20.03.2012 Похожие документы
... Вернуться к предыдущей задаче . ... Задача ?13 . ОПРЕДЕЛЕНИЕ ФИЗИЧЕСКИХ ПАРАМЕТРОВ ГАЗА В ЯДРЕ . СЕЙФЕРТОВСКОЙ ГАЛАКТИКИ . ... Ядро характеризуется необычайно широкими эмиссионными линиями, свидетельствующими о движении газа со скоростями в тысячи км/с. В настоящей задаче исследуется спектрограмма ядра сейфертовской галактики, и по относительным интенсивностям спектральных линий определяются физические параметры излучающего газа. ... Определить параметры газа в ядре сейфертовской галактики. ...
... Porokhov, N., Kalabukhov, A., Chukharkin, M., Maresov, A., Khrykin, D., Klenov, N., and Snigirev, O. The physical basis of the fabrication of the third generation of high-temperature superconducting wires on quartz substrates.љ ... DOI љ] . ... Journal of Superconductivity and Novel Magnetism љ(2014). ... Сhukharkin, M., Kalaboukhov, A., Schnaiderman, J., Oisjoen, F., Jonsson, M., Xie, M., Snigirev, O., Winkler, D. Novel hts dc squid solutions for nmr applications. ... Superconducting electronics . ...
... Philosophical Transactions of the Royal Society (Biological Sciences) . ... Biochimica et Biophysica Acta (Elsevier Science) . ... Discrete and Continuous Dynamical Systems, Series B (American Institute of Mathematical Sciences) . ... Physics in Medicine and Biology (Institute of Physics) . ... Mathematical Medicine and Biology: A Journal of the IMA . Mathematical Medicine and Biology will publish original articles with a significant mathematical content addressing topics in medicine and biology. ...
... The experimental data obtained using Cherenkov light of EAS reflected from the snow surface of the Big Alma-Ata Lake (Kazakhstan) are presented. ... The balloon-borne measurements in the energy range 10 15 -10 20 eV are planned. ... SPHERE detector array was elaborated for balloon-borne experiment [3-5]. ... SPHERE detector was situated on the 160 m high mountain ledge nearby the B.Alma-Ata lake (2500 m above sea level) to detect Cherenkov light reflected from the snow surface of the lake. ...
... Елена Фоменко (2 курс). ... Руководитель В. И. Буник, отдел биокинетики НИИ ФХБ им. А.Н.Белозерского МГУ. ... Руководитель А.Г. Евстафьева, отдел химии и биохимии нуклеопротеидов НИИ ФХБ им. А.Н. Белозерского МГУ. ... Руководитель Н.В. Чичкова, лаборатория молекулярной биологии гена отдела химии и биохимии нуклеопротеидов НИИ ФХБ им. А.Н. Белозерского МГУ. ... Руководитель А.Г. Евстафьева, лаборатория молекулярной биологии гена отдела химии и биохимии нуклеопротеидов НИИ ФХБ им. А.Н. Белозерского...
... There are corresponding results showing that the Poincare duals of certain totally ge odesic cycles, which we will call "special cycles", span a definite part (a refined Hodge component) of the cohomology of the locally symmetric spaces of standard arithmetic type associated to the orthogonal groups O(p, q). ... Math. ... KLM3] (with B. Leeb and M. Kapovich) The generalized triangle inequalities in symmetric spaces and buildings with applications to algebra, Memoirs of the AMS, Vol. ...
[
Текст
]
Ссылки http://www.dubrovinlab.msu.ru/files/Alltogether.pdf -- 334.8 Кб -- 15.09.2012
[
Текст
]
Ссылки http://dubrovinlab.msu.ru/files/Alltogether.pdf -- 334.8 Кб -- 15.09.2012 Похожие документы
... The Department of Operations Research . April 9, 2016 . Welcome Traditional topics of the conference Important dates Abstracts Registration . ... dedicated to the outstanding Russian scientists . ... Moscow, April 10-14, 2007 Welcome . ... Dorodnicyn Computing Center of RAS, Computational Mathematics and Cybernetics Faculty of the M.V.Lomonosov Moscow State University and Russian Scientific Operations Research Society will organize the Vth Conference in April 2007 in Moscow. ...
О кафедре . ... Динамические задачи теории упругости . Динамика пластин и оболочек . ... Методы теории упругости . ... Нелинейная теория упругости . ... Пластины и оболочки . ... Теория и расчет оболочек тонкостенных летательных аппаратов . ... Теория упругости структурно-неоднородных тел . ... Уравнения изгиба пластин классическая линейная теория. ... Колебания пластин. ... Oscillation of plates . ... МГУ им. М.В.Ломоносова, механико-математический факультет, кафедра теории упругости . ...
... site navigation | footer (site information) . IChO-2007 Participation Problems IChO RUSSIA Sponsors search . ... Moscow-1996 | ... Chemistry Department | ... Homepages of National Competitions Other International Science Olympiads Previous IChO's Miscellaneous Chemistry sites . ... Some fresh information is available. A letter from the President of 39th IChO . ... Information about post-Olympiad tour is now available . ... Information about guides of 39th IChO is now available. ...
... В.Е.Фортов, В.К.Грязнов, А.А.Леонтьев, В.Б.Минцев, В.Е.Беспалов, Ю.В.Иванов IV Всесоюзная конференция по физике низкотемпературной плазмы. ... Experimental study of a dense xenon plasma under high pressures. V.B.Mintsev Proc. of 2-d Int.workshop on non-ideal plasmas. ... Yu.B. Zaporogets, V.B.Mintsev, V.E.Fortov In book: Current topics in shock waves, New York, 1989, p.549-555. ... Strongly coupled plasma physics at megabar pressures V.E.Fortov, V.B.Mintsev In book: High Pressure phenomena. ...