Кафедра высокопроизводительных вычислений МГУ . Главная . ... Главной задачей кафедры является организация и осуществление на высоком уровне учебно-воспитательной работы по подготовке специалистов высокой профессиональной квалификации по высокопроизводительным вычислениям на многопроцессорных ЭВМ из числа студентов 2-5 курсов механико-математического факультета , физического факультета , факультета вычислительной математики и кибернетики, химического факультета и других факультетов ...
About SPAW Editor . ... As of final version 1.0 of the control you'll need to rename the file spaw_control.default.config.php in config sub-directory to spaw_control.config.php when installing control for the first time. ... All of the SPAW Editor configuration options are located in the config/spaw_control.config.php file. ... This file will be included in img_library.php (Image library dialog script). $request_uri variable will be set to the URL of the page where SPAW Editor instance resides. ...
... Полная версия: international, supadance, ray rose . Грация-МГУ::Форум > Дискуссии > Танцевальная жизнь > Танцевальная обувь . ... Oct 30 2006, 15:11 . ... Последний стандарт - Ray Rose. ... Nov 3 2006, 15:21 . Цитата(scarler @ Oct 30 2006, 15:11) . ... Не подскажете, можно ли заказать Ray Rose по и-нету? Говорят, их можно купить только в Англии . ... Цитата(Ира @ Nov 3 2006, 16:21) . ... Цитата(scarler @ Nov 9 2006, 15:55) . ... Nov 15 2007, 09:42 . ... Oct 14 2009, 23:01 . ...
... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...
[
Текст
]
Ссылки http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/poster_mccmb_2011.pdf -- 225.5 Кб -- 21.07.2011 Похожие документы
... Проводится запись на очные курсы СУНЦ МГУ на 2011-12 учебный год . ... ФМШ.ру - обучение одаренных детей . ... СУНЦ МГУ школа им. А.Н.Колмогорова . ...
... Публикации . ... О ВШГА МГУ . ... ВШГА МГУ - это подготовка кадров среднего и высшего звена для органов государственной власти РФ, крупных государственно-частных корпораций и бизнес-структур. ... Журнал "ПРОЕКТНОЕ ФИНАНСИРОВАНИЕ - INTERNATIONAL AND RUSSIAN PROJECT FINANCE" . В журнале "ПРОЕКТНОЕ ФИНАНСИРОВАНИЕ - INTERNATIONAL AND RUSSIAN PROJECT FINANCE", ?6 (006) 2010г. опубликованы статьи администрации, профессорско-преподавательского состава и студентов ВШГА МГУ . ... Новости и публикации | ...
... 000, 112 (2009) Printed 11 February 2010 A (MN L TEX style file v2.2) Analytical approximations of K -corrections in optical and near-infrared bands I1gor V. Chilingarian1 2 ,2,3 , Anne-Laure Melchior 1,4 and Ivan Yu. ... Received 2010 February 01; in original form 2009 August 14 ABSTRACT To compare photometric properties of galaxies at different redshifts, the fluxes need to be corrected for the changes of effective rest-frame wavelengths of filter bandpasses, called K -corrections. ... Table 1. ...
To use Microsoft Outlook Web access, browser settings must allow scripts to run. ... If your browser does not support scripts, you can download Microsoft Internet Explorer for access to Outlook Web Access. ... Select this option if you use Outlook Web Access on a public computer. ... This is a private computer . ... Use Outlook Web Access Light . ... Type the address for Outlook Web Access into the field, click Allow, and then click OK to save your changes. Connected to Microsoft Exchange . ...
... Abstract A Uniform Resource Identifier (URI) is a compact string of characters for identifying an abstract or physical resource. ... This document defines a grammar that is a superset of all valid URI, such that an implementation can parse the common components of a URI reference without knowing the scheme-specific requirements of every possible identifier type. ... URI-reference = [ absoluteURI | ... Otherwise, the reference URI's scheme is inherited from the base URI's scheme component. ...
Revised: 21 May 2014, Accepted: 27 May 2014, Published online in Wiley Online Library (wileyonlinelibrary.com) DOI: 10.1002/jmr.2399 Force -induced globule-coil transition in laminin binding protein and its role for viral- cell membrane fusion Boris N. Zaitseva, Fabrizio Benedettib,e, Andrey G. Mikhaylovb, Denis V. Korneeva, Sergey K. Sekatskiib*, Tanya Karakouzb, Pavel ... 2008, 2010). ... This should permit us to elucidate still unclear aspects of viral-cell membrane interaction and fusion. ...
[
Текст
]
Ссылки http://cell.biophys.msu.ru/static/announce/media/files/Force-induced_globule-coil_transition_in_laminin_binding_protein_and_its_role_for_viral-cell_membrane_fusion.pdf -- 1182.2 Кб -- 30.11.2015 Похожие документы
... 5-я летняя школа по геометрическим методам математической физики, 23-26 июня 2015 г. new . ... Лаборатория "Геометрические методы математической физики" была создана в декабре 2010г. после объявления победителей гранта Правительства Российской Федерации для государственной поддержки научных исследований, проводимых под руководством ведущих ученых в российских образовательных учреждениях высшего профессионального образования. ... на семинаре "Геометрия и группы" состоится доклад: . ...
... H. Purcell's masque opera "The Fairy Queen" (1692) . ... and John Gay's ballad opera "The Beggar's Opera" (1728) . ... The performance is based on the popular music of the time: English and Scottish folk songs and ballads, Purcell's and Handel's tunes (among them the famous chorus from "The Fairy Queen" "I pressed her hand gently" and popular march "Let us take the road" from Handel's opera "Rinaldo", which is still played in front of the Buckingham Palace during the changing of the guard). ...
W elcome to LHE guests page . ... 1) Enter metro station, buy a metro ticket in the ticket-office if You have not it yet. ... You will find a table with the prices near the ticket-office. ... 1) Buy a bus ticket in a kiosk near the bus stop if You have not it yet. ... It is possible to buy a ticket for 1 trip from the bus driver (28 rub). 2) Enter a bus through the front door, stick your ticket into a machine near the turnstile and take it. ... You can find more information on this site . ...
... For 1st and 2nd-year students . Introduction to quantum physics . ... 2nd-year course work topics . ... Leading Researcher . Senior Researcher . ... Research Associate . 7(495)939-4372 (4) . ... The Laboratory performs research activity in the following directions: . Quantum optics of biphoton fields . Quantum optics of pulsed fields . ... Terahertz generation and detection . ... Quantum photometry in the terahertz range . ... 2003 2016 Department of Quantum Electronics . ...
... Web portal on atmospheric environment is developed by international consortium as a be-lingual information resource in area of atmospheric physics and chemistry and in related domain air quality assessment and management. ... The portal has all typical component and services like collections of links, user group registration, discussion forum, etc. ... Each scientific site is an information-computational system designed in Internet technologies. ... 00189 138. ... 2003 . ... 2002, 252 . ...
... О межфакультетских курсах МГУ . Видео МФК . ... Канал МГУ на YouTube . ... Комментарии Дата Просмотры Лайки Комментарии Упорядочить по возрастанию . ... x25BA; Кинофонд МГУ (95) . ... x25BA; Фильмы о МГУ (5) . ... x25BA; СУНЦ МГУ (5) . ... x25BA; МФК (1084) . ... x25BA; Механико-математический факультет (5) . ... x25BA; Социологический факультет (13) . ... x25BA; Факультет журналистики (11) . ... x25BA; Факультет наук о материалах (7) . ... Copyright 2016 ї Видеоархив МГУ имени М.В.Ломоносова . ...
... НИИЯФ МГУ . ... Для того, чтобы результаты участия были учтены для поступления в магистратуру кафедры Физики элементарных частиц, при регистрации в поле "Предполагаемая магистерская программа" нужно указать "Физика элементарных частиц". ... Целевой прием-2016 на физфак МГУ, сообщение 1 . ... кафедра Физики Элементарных Частиц и кафедра Нейтронографии ? ... На лекции будет рассказано о гравитационных волнах, проекте LIGO и вкладе научной группы с кафедры физики колебаний физического факультета МГУ. ...
... БИБЛИОТЕКА НИИЯФ МГУ . ... Полный список журналов ELSEVIER и SpringerLink доступных в 2011 году . ... Электронные ресурсы НИИЯФ МГУ . ... Acta Physica Hungarica, New Series, Heavy Ion Physics . ... Applied Physics Letters . ... аннотации . ... Astrophysical Journal, Astrophysical Journal Letters, Astrophysical Journal Supplement series . ... Journal of Physical Chemistry A . ... The European Physical Journal - Applied Physics . ... The European Physical Journal E: Soft Matter and Biological Physics ...