Координатор семинара : академик РАН и Academia Europaea Алексей Ремович Хохлов . ... Заседания семинара проводятся в Конференц-зале Института элементоорганических соединений им. А.Н. Несмеянова РАН ( ИНЭОС РАН , г. Москва, ул. Вавилова, 28). ... Скачать объявление о семинаре . ... Б.М. Графов (Интститут физической химии и электрохимии имени А.Н. Фрумкина РАН, Москва) . ... После доклада предполагается обсуждение целесообразности организации Общемосковского семинара по электрохимии. ...
Bird Species Database (BSD) is being compiled in a framework of the Arctic Birds Breeding Conditions Survey (ABBCS) of the International Wader Study Group (IWSG). BSD aims at providing information on distribution, numbers and breeding status of birds in the Arctic, with the focus on last-breaking and, thus usually unpublished information. The primary source of data is questionnaires filled in by contributors to the ABBCS, while data from literature are being added occasionally. ... breeding . ...
... В.И.Дмитриев Электромагнитные поля в неоднородных средах Изд-во Моск. ун-та, Москва 1969, с.131 . ... Изд-во 'Диалог-МГУ', 1997,с.168. ... Прикладная математика и информатика', Изд-во 'Диалог-МГУ', 1999,с. 68-77. ... Прикладная математика и информатика', изд-во 'МАКС Пресс', Москва, 2001г.,?7, с.5-18. ... В трудах 'Прикладная математика и информатика', ?2, Изд-во 'Диалог-МГУ', 1999,с. 5-17 . ... Сборник работ 'Прикладная математика и информатика', изд-во 'МАКС Пресс', Москва, 2001г., ?9, с. 46. ...
... Okhapina, E. Y. The Boundary Zones of the Eastern Urals . Natural restrictions of the East Uralian structures are two intensive deformed boundary zones, which are the Sheludivy Gory Boundary Zone (SGBZ) in the west and the Redutovo Boundary Zone (RBZ) in the east. SGBZ represents a package lens-shaped and steeply dipping faulted blocks, horizontal dimension of which usually does not exceed 2 km. ... Deformation degree in this boundary zone are significantly higher than in the former. ...
... The experimental data obtained using Cherenkov light of EAS reflected from the snow surface of the Big Alma-Ata Lake (Kazakhstan) are presented. ... The balloon-borne measurements in the energy range 10 15 -10 20 eV are planned. ... SPHERE detector array was elaborated for balloon-borne experiment [3-5]. ... SPHERE detector was situated on the 160 m high mountain ledge nearby the B.Alma-Ata lake (2500 m above sea level) to detect Cherenkov light reflected from the snow surface of the lake. ...
... Journals . Memoirs of the Faculty of Physics . Moscow University Physics Bulletin . ... The conference papers from the School-Seminar ?Waves-2014? will be submitted for publishing in the Memoirs of the Faculty of Physics journal. ... Moscow University Physics Bulletin was founded in 1946 by Lomonosov Moscow State University and the Faculty of Physics. ... World-known physicists working at the Faculty of Physics (including 8 Nobel laureates) used to be and are the authors of the journal. ...
... кафедра Исследования операций . ... Приветствие Традиционные темы конференции Основные даты Оформление тезисов Регистрация Программа конференции Размещение Программный коммитет Организационный коммитет Координаторы Контактная информация . ... 10-14 апреля 2007 Программа конференции . ... академик РАН А.А. Петров . ... А.В. Кузнецова, В.И.Лукьянов, О.А.Максакова, И.С.Меньшиков, О.Р. Меньшикова, О.В. Сенько . ... секция . ... МГУ, ВМК, ауд. ... 11 апреля 2007 . ... среда, 11 апреля 2007, ауд. ...
... Главная :: Проекты . ... Проекты: . ... На сегодняшний день существуют инструменты, позволяющие лишь в некоторой степени оценить степень использования ресурсов вычислительных комплексов. ... Разрабатываемый программный комплекс призван ответить на ключевые вопросы в области эффективности, причем как для администраторов вычислительных систем, так и для пользователей. ... 50 самых мощных вычислительных систем СНГ . ... Информационно-аналитический центр . ... История Московского университеты" . ...
Лекции Dr. Sheldon Landsberger, профессор университета Техаса USA. Дубна, 14.04.2014 . Информируем Вас и приглашаем посетить лекции Dr. Sheldon Landsberger, . Professor in the Nuclear and Radiation Engineering Program in the Mechanical Engineering Department at the University of Texas at Austin, USA . ... Applications in Environmental Analysis Лекции будут проходить в конференц-зале ЛНФ в следующие дни: . ... Аннотация в приложении: hep.msu.dubna.ru/main/file.php/74/Landsberger.zip . ...
WRF . ... NCEP/NCAR, . ... WRF (Weather Research and Forecasting Model), , ' -35' (-35) ' -36' (-36). ... 11.12.2007 . ... 100 % . ... 400 . ... Fels S.B., Schwarzkopf M.D. The simplified exchange approximation: a new method for radiative transfer calculations // Journal of the Atmospheric sciences. ... Vol. ... Janjic Z.I. The surface layer in the NCEP Eta model. ... Janjic Z.I. Nonsingular Implementation of the Mellor-Yamada Level 2.5 Scheme in the NCEP Meso model // NCEP Office Note. ...
[
Текст
]
Ссылки http://atm563.phys.msu.ru/rus/gidromet_public_html/trudy/thmc3440111.pdf -- 1474.5 Кб -- 14.03.2011 Похожие документы
Information letter Dear colleagues! Faculty of Basic Medicine, Lomonosov Moscow State University and State Research Center Institute for Biomedical Problems, Russian Academy of Science would like to invite you to participate in the work of the VII Russian National School with International Participation on Muscle and Exercise Physiology «New approaches to studying of classical problems». ... Abstracts of reports will be published. ... The receipt of your abstract will be confirmed by e-mail. ...
О кафедре . ... Динамические задачи теории упругости . Динамика пластин и оболочек . ... Методы теории упругости . ... Нелинейная теория упругости . ... Пластины и оболочки . ... Теория и расчет оболочек тонкостенных летательных аппаратов . ... Теория упругости структурно-неоднородных тел . ... Уравнения изгиба пластин классическая линейная теория. ... Колебания пластин. ... Oscillation of plates . ... МГУ им. М.В.Ломоносова, механико-математический факультет, кафедра теории упругости . ...
May 12, 1998 NOTES from May 9, 1998: The format of the Solar Event Lists was changed to include a standard SEC style header. ... Please send comments and suggestions to sec@sec.noaa.gov # # Missing data: //// # # Edited Events for 1998 May 11 # # Event Begin Max End Obs Q Type Loc/Frq Particulars Reg# #------------------------------------------------------------------------------- 2560 A0146 //// 1225 HOL ... The UT day of the event's begin time is the UT day of the list. ...
... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...
[
Текст
]
Ссылки http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/poster_mccmb_2011.pdf -- 225.5 Кб -- 21.07.2011 Похожие документы
... California State College at Los Angeles, 1966. -115p. Essays on Rhetorical Criticism. ... Cornell University Press. ... Cambridge ; New York : Cambridge University Press, 1979. x, 501 p. Boulton, James T. The criticism of rhetoric and the act of communication // Essays on Rhetorical Criticism. ... Burke Kenneth. ... The philosophy of literary form : studies in symbolic action / Kenneth Burke. 3d ed. Berkeley: University of California Press, [1974] c1973. xxvi, 463 p. Burke Kenneth. ...
? ? 1.???????????????? 3 2.Реформа и инновации в сфере государственных услуг в России. 8 3.Особенности развития экономики Шэньчжэня 26 4.в условиях модификации модели роста в КНР 26 5.???????????????? 39 6.СРАВНИТЕЛЬНЫЙ ОПЫТ УЧАСТИЯ РОССИИ И КИТАЯ В ИНСТИТУТАХ ГЛОБАЛЬНОГО УПРАВЛЕНИЯ 41 7.Принципы развития межрегиональных центров подготовки кадров для государственного управления в Российской Федерации 59 8.??????????????? 74 9.Региональные особенности государственного регулирования сферы образования в РФ 82
... The laser system in which an optoelectronic negative feedback is realized by means of a signal reflected from an intracavity Pockels cell polarizer is proposed and tested. The design provides flexible control over pulse train time structure. ... Stable self -mode-locking occurs due to time delay in feedback control system corresponding to light pulse passage through the Pockels cell at the moment of low intracavity losses. ... The scheme of discontinuous control in the laser is shown in Fig. ...
... Библиотека / The Somoninge of Everyman . ... GOD . ... EVERYMAN . ... FELAWSHIP . ... GOODES . ... GOOD DEDES . ... In my glory sholde make his mansion, . ... Where arte thou, Deth, thou mighty messengere? ... Hast thou thy Maker forgete? ... Thy many badde dedes, and good but a fewe, . ... And yet, if thou wilte ete, and drinke, and make good chere, . ... Good Dedes, I praye you helpe me in this nede, . ... Helpe my Good Dedes for my piteous exclamacion! . ... The Good Dedes shall make all sure. ...