The Lomonosov Moscow State University Faculty of Educational Studies The MSU FES offers various educational programs: 1. Master program "Education Management"; 2. ... Qualification training programs "School Teacher" and "Higher School Teacher". The FES was founded in 1997 with the main goal to teach those students of the MSU faculties who wished to receive the qualification of Secondary and Higher School teacher & lecturer in addition to their basic speciality. ...
[
Текст
]
Ссылки http://www.fpo.msu.ru/open_files/fpo2015_eng.pdf -- 81.9 Кб -- 31.10.2015
[
Текст
]
Ссылки http://fpo.msu.ru/open_files/fpo2015_eng.pdf -- 81.9 Кб -- 31.10.2015 Похожие документы
... Gpu | ... 10 , MULtI- GPU ABSoft Neat Video Adobe After Effects CC Autodesk Flame Premium Boris FX Continuum Complete Cinnafilm Dark Energy Plug-in CoreMelt complete eyeon Fusion GenArts Monsters Gt GenArts Sapphire roBUSKEY Neat Video open FX NewBlueFX Video Essentials NewBlue titler Pro Pixelan AnyFX re:Vision Effects red Giant Effects Suite red Giant Magic Bullet Looks the Foundry HIEro the Foundry NUKE and NUKEX Video Copilot Software Element 3D ... Q=Quadro Gpu, T=Tesla Gpu. ...
[
Текст
]
Ссылки http://ccoe.msu.ru/sites/default/files/RU_Apps_Catalog_Sep13_LR.pdf -- 131.1 Кб -- 10.12.2013 Похожие документы
... Faculty of Physics . ... Research Centers . ... Search Faculties Staff . Education . ... Any division Budget Depatment Center of Computer Physics (CCP) Center of Education Quality Control Center of Hydrophysical Studies Center of Information Systems and Technologies (CIST) Chair of Acoustics Chair of Astrophysics and Stellar Astronomy Chair of Atomic Physics , Plasma Physics , and Microelectronics Chair of Biophysics Chair of Celestial Mechanics, Astrometry, and Gravimetry ...
Кафедра общей топологии и геометрии . ... Публикации . ... Сипачева О.В. , The Topology of Free Topological Groups, Journal of Mathematical Sciences, vol. 131, no. 4, 2005, pp. ... Сипачева О.В. , Топология свободной топологической группы, Общая топология и топологическая алгебра. ... Резниченко Е.А. , Сипачева О.В. , The Fr\'echet--Urysohn and $\alpha_2$-properties in separable spaces, groups, and locally convex spaces, 13th Summer Conf. on General Topology and Its Applications, Mexico, 1998, pp.~ ...
... In my opinion, it became the landmark for Russian education. ... This means academic mobility, joint scientific research, joint development of new forms of evaluation of the quality of education, including new mechanisms of the global rating of institutions of higher education. All this will contribute to prevention of the current trend to breakage of ties between the key subjects of the educational process: students' and teachers' corporations, employers, state and social institutes. ...
... Submit your article . ... The article reveals peculiarities of the development of the high-tech sphere in the global economic environment. ... The role of venture ecosystem as a source of development of the high-tech sphere is examined in the article. The author identifies the problems of development of Russian venture ecosystem and demonstrates its prospects of an effective symbiosis of the state and the private initiatives against the background of favourable institutional conditions. ...
... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...
[
Текст
]
Ссылки http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/poster_mccmb_2011.pdf -- 225.5 Кб -- 21.07.2011 Похожие документы
... Совместно с сотрудниками физического факультета МГУ предложена простая конечномерная модель геодинамо, полученная из уравнений электродинамики средних полей и воспроизводящая феномен инверсий геомагнитного поля (рис 1). ... Сейсмические рои были подвергнут анализу согласно разработанной на кафедре физики Земли методике: были оценены параметры сейсмического режима роев и исследованы их вариации во времени. ... сотрудников кафедры физики Земли за 2010-2011 год. ... Вестник Московского университета. ...
. Strict Standards : Non-static method JLoader::import() should not be called statically in /wcmc/ms/ms/libraries/joomla/import.php on line 29 . Strict Standards : Non-static method JLoader::register() should not be called statically in /wcmc/ms/ms/libraries/loader.php on line 71 . Strict Standards : Non-static method JLoader::import() should not be called statically in /wcmc/ms/ms/libraries/joomla/import.php on line 32 . Strict Standards : Non-static method JLoader::register() should not be called
Summary of SUNY/MSU Center Activities . ... May 11, 2000: First meeting of the Board of Directors, SUNY Center on Russia and the United States. ... After some discussion, it was decided that SUNY and MSU would collaborate on the offering of three new SLN courses for spring 2001: Doing Business in Russia (SUNY Oneonta and MSU Faculty of Foreign Languages); Russian studies (SUNY Cortland and MSU Faculty of Foreign Languages), American studies (SUNY Buffalo and MSU Faculty of History). ... suny-msu . ...
The beamer class Manual for version 3.06. \begin{frame} \frametitle{There Is No Largest Prime Number} \framesubtitle{The proof uses \textit{reductio ad absurdum}.} \begin{theorem} There is no largest prime number. \end{theorem} \begin{proof} \begin{enumerate} \item<1-| alert@1> Suppose $p$ were the largest prime number. \item<2-> Let $q$ be the product of the first $p$ numbers. \item<3-> Then $q+1$ is not divisible by any of them. \item<1-> Thus $q+1$ is also prime and greater than $p$.\qedhere
www.vovr.ru 1992 14 · 1 0 , 20 12 CHUCHALIN A., GERASIMOV S. THE COMPETENCES OF ENGINEER ING PROGRAMS GRADUATES: NATIONAL AND INTERNATIONAL STANDARDS The issues of modernization of criteria used by Association of Engineering Education of Russia i n public accreditation HEI's engi neeri ng education programs ar e analyzed in the paper. ... Key word s: Russian higher professional educati on reform, federal state educatio nal standards (FSES), FSES based HEI's undergraduate educational programs. ...
[
Текст
]
Ссылки http://www.umo.msu.ru/docs/projects/monitoring/eksp_analiz_oop_10_12.pdf -- 175.9 Кб -- 01.04.2013 Похожие документы
Published on Совет молодых ученых ВМК МГУ ( http://smu.cmc.msu.ru ) . Главная > Мероприятия > Конференция ?Ломоносов? > 2013 . ... XX Международная конференция Ломоносов-2013 проходит с 9 по 12 апреля 2013 года. Официальный сайт конференции Ломоносов -љ http://lomonosov-msu.ru [1] . ... Руководители: Шевцова Ирина Геннадьевна, Нефедова Юлия Сергеевна . ... Ответственный секретарь љ? ассистент к.ф.-м.н. Шевцова Ирина Геннадьевна . ... Программа секции ВМК 9-11 апреля 2013г. [3] . ...
Published on Совет молодых ученых ВМК МГУ ( http://smu.cs.msu.ru ) . Главная > Мероприятия > Конференция ?Ломоносов? > 2013 . ... XX Международная конференция Ломоносов-2013 проходит с 9 по 12 апреля 2013 года. Официальный сайт конференции Ломоносов -љ http://lomonosov-msu.ru [1] . ... Руководители: Шевцова Ирина Геннадьевна, Нефедова Юлия Сергеевна . ... Ответственный секретарь љ? ассистент к.ф.-м.н. Шевцова Ирина Геннадьевна . ... Программа секции ВМК 9-11 апреля 2013г. [3] . ...
Published on Совет молодых ученых ВМК МГУ ( http://smu.cs.msu.su ) . Главная > Мероприятия > Конференция ?Ломоносов? > 2013 . ... XX Международная конференция Ломоносов-2013 проходит с 9 по 12 апреля 2013 года. Официальный сайт конференции Ломоносов -љ http://lomonosov-msu.ru [1] . ... Руководители: Шевцова Ирина Геннадьевна, Нефедова Юлия Сергеевна . ... Ответственный секретарь љ? ассистент к.ф.-м.н. Шевцова Ирина Геннадьевна . ... Программа секции ВМК 9-11 апреля 2013г. [3] . ...
... May, 2005 . ... Moscow State University Russian Language Centre . Moscow State University . ... Learn Russian at the Moscow State University! Moscow Easter Festival comes to MGU . Classical music concerts in the Moscow State University happen often enough and always they are a holiday for professors and students. (more.. ... Group summer program "Moscow holidays" is the most popular group program at our Centre! ... Russian proverbs and sayings about Russian language: . ...