... The Lectures Contents: Lecture one: Contemporary Historical and Political Background Part One: The Historical Stages of the Arab Political Development Part Two: The Nature of the Arab Political Systems and the Arab Modern Wars Lecture Two: The Middle East Scenario of Crisis and Conflict Part One: The Israeli/Palestine Crisis Part Two: The Superpowers' Role in the Arab Affairs Lecture Three: The Arab Modern Regional Politics Part One: The Arab Politics towards its Unitarian Movements. ...
... We thank the Swift team for their rapid scheduling of this observation. ... 2455705.20851 V 14.15 0.03 2455707.83079 V 14.10 0.03 2455710.84028 V 13.53 0.02 2455713.64631 V 13.66 0.02 2455714.65479 V 14.11 0.03 2455714.71823 V 14.12 0.02 2455714.78596 V 14.20 0.02 2455717.39593 V 14.37 0.03 2455726.62861 V 14.83 0.04 2455727.16343 V 14.57 0.04 2455730.50586 V 14.57 0.03 2455730.57329 V 14.56 0.03 2455730.70360 V 14.66 0.04 2455738.32865 V 14.00 0.02 2455742.86146 V 14.21 ...
... About hotel . ... Rooms and prices . ... The hotel ?69th Parallel? is glad to present its renewed website which now has an option of online booking! ... The hotel ?69th Parallel? offers comfortable single and twin rooms and deluxe rooms relevant to the European standards. Every room has free WiFi connection. ... SINGLE STANDARD ROOM . Single occupancy ? 1 800 rub./day . ... 200 rub./person . ... 2 200 rub./day . ... The prices are in rubles for room a day and include the VAT (18%) . ...
Вы посетили: conf_engl.html . ... International Algebraic Conference dedicated to 70th birthday of professor A.V. Mikhalev, Russia, Moscow, November 2010 . ... International Algebraic Conference dedicated to the 100-year anniversary of professor A.G. Kurosh, Russia, Moscow, May 2008 . ... 2nd International Conferences on Matrix Methods and Operator Equations, Russia, Moscow, July 2007 . ... staff/guterman/conf_engl.html.txt Последние изменения: 13.02.2013 11:26 (внешнее изменение) | ...
MOSCOW STATE UNIVERSITY The Scientific Society of students of the Law Faculty January 25, 2014 1- The flyer of the Unit `Jurisprudence' of International scientific conference "Lomonosov - 2014" 1. ... The organizers of the Unit are the law faculty of Moscow State University and the Scientific Society of students of the law faculty. ... Administrative law 2. ... The Organizing Committee: Presiding Officer Kozlova Natalya Vladimirovna (Deputy Dean of Law Faculty on study, Doctor in Law, Professor). ...
[
Текст
]
Ссылки http://law.msu.ru/bitcache/bc6ca81fd934d7083472270ea392667daf49eebb?vid=30191&disposition=attachment&op=download -- 260.2 Кб -- 28.02.2014 Похожие документы
... Публикации . ... 1, 012506 DOI . ... 1, 012509 DOI . ... 1, 103598 DOI . ... Edge field emission of large-area single layer graphene Kleshch V.I., Bandurin D.A., Orekhov A.S., Purcell S.T., Obraztsov A.N. Applied Surface Science, Elsevier BV (Netherlands) DOI . ... Graphene Formation on Surfaces of Single Crystal Metals Shvets P.V., Soon J.M., Verger A., Obraztsov A.N Journal of Nanoelectronics and Optoelectronics, American Scientific Publishers (United States) DOI . ... Материалы, ? ...
... An extended set of observables of the nuclear quasi-free (p, d + ) reaction including the triple differential cross-section for coincidence measurements, its analyzing power in case of polarized proton beams and, also, the parameters of the polarization of the excited recoil nucleus and the produced deuteron are considered in the framework of the distorted-wave impulse approximation using the reaction 16 O(p, d + )15 N at a proton energy of 650 MeV as an example. ...
[
Текст
]
Ссылки http://np-chair.sinp.msu.ru/download/epja100510-offprints.pdf -- 426.2 Кб -- 18.03.2015 Похожие документы
... 1997. ... Federation and regional policy . ... territorial unity' and 'self-definition of peoples' . in the Constitution of the Russian Federation .. ... Natio territorial organization of the state .. ... Local legislation: . ... The problems of scanty peoples of Russian North .. ... Bills and legislative proposals. ... On the question of legislative regulation . of the state antialchohol policy .. ... The Principal Decisions of the State Duma . in December 1996 - January 1997 .. ...
hpc@cmc . Высокопроизводительные вычисления на ВМК МГУ . Blue Gene/P . Regatta . ... Серия Blue Gene в мире . ... Факультет вычислительной математики и кибернетики МГУ . ... parallel.ru . ... Parallel Computing . ... Некоммерческое программное обеспечение Intel : . ... Часть ссылок и описаний к ним любезно предоставлена администратором сайта кафедры АНИ факультета ВМК МГУ имени М. В. Ломоносова . Факультет ВМК МГУ . ... 2008 2013 Факультет ВМК МГУ имени М. В. Ломоносова . ...
... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...
[
Текст
]
Ссылки http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/poster_mccmb_2011.pdf -- 225.5 Кб -- 21.07.2011 Похожие документы
THE ROLE OF DEVELOPING NATION TOWARDS COMBATING THE CYBER CRIME Abhishek Vaish and Satya Prakash, Indian Institute of Information Technology, Allahabad. ... Highlights on the recent trends: A report of Indian computer Emergency Response Team (CERTIN) shows that more than 2500 incidents were registered and handled in the year 2008. ... Others security incidents reported in the year 2004 was 4, in the year 2005 was 18, in the year 2006 was 17, in the year 2007 was 264 and in the year 2008 was 94. ...
[
Текст
]
Ссылки http://www.iisi.msu.ru/UserFiles/File/bayern2010/vaish_ea.pdf -- 652.4 Кб -- 02.04.2012 Похожие документы
... Продолжалась обработка данных эксперимента ZEUS на коллайдере HERA. ... By D0 Collaboration [arXiv:1011.1931] FERMILAB-PUB-10-446-E (Nov 2010) 10p. 2) A measurement of the ratio of inclusive cross sections $\sigma(p\bar{p}\rightarrow Z+b{\rm\, jet})/ \sigma(p\bar{p}\rightarrow Z+{\rm jet})$ at $\sqrt{s}=1.96$ TeV. ... ZEUS Collaboration (S. Chekanov et al.) ... By CMS Collaboration [arXiv:1010.4439] CMS-EXO-10-002 (Oct 2010) 3) Search for Dijet Resonances in 7 TeV pp Collisions at CMS. ...
... Зорич Владимир Антонович . ... Профессор кафедры Математического анализа механико-математического факультета МГУ. ... Автор 85 математических работ (2012) и университетского учебника по математическому анализу для студентов физико-математических специальностей. ... Зорич В. А., Математический анализ задач естествознания , МЦНМО, М., 2008 . ... В.А.Зорич, Математический анализ задач естествознания. ... В.А.Зорич, Математический анализ (в двух томах: части I и II). ... В.А.Зорич, Математический анализ...
... One of the project objectives was to investigate practical efficiency of some modern iterative methods, including multigrid techniques and domain decomposition methods as well as methods for small compressible materials. ... Hence, the project research initiated because of INTAS financial support contributes in setting up modern computational techniques in tire design. ... Research on efficiency of iterative methods was conducted at the department of Mechanics of Composites about ten years ago. ...
Заведующий кафедрой Head of the Chair . ... История кафедры . ... В 1966 г. для расширения ведущихся на кафедре научных работ в НИИ Ядерной физики МГУ был создан отдел физики плазмы (ОФП), в 1989 году переименованный в отдел микроэлектроники (ОМЭ). ... Сегодня по различным научным направлениям, ведущимся по специальностям, преподаваемым на кафедре атомной физики, физики плазмы и микроэлектроники, работает около 100 научных сотрудников, среди которых 12 докторов наук и около 50 кандидатов наук. ...
... There are corresponding results showing that the Poincare duals of certain totally ge odesic cycles, which we will call "special cycles", span a definite part (a refined Hodge component) of the cohomology of the locally symmetric spaces of standard arithmetic type associated to the orthogonal groups O(p, q). ... Math. ... KLM3] (with B. Leeb and M. Kapovich) The generalized triangle inequalities in symmetric spaces and buildings with applications to algebra, Memoirs of the AMS, Vol. ...
[
Текст
]
Ссылки http://www.dubrovinlab.msu.ru/files/Alltogether.pdf -- 334.8 Кб -- 15.09.2012
[
Текст
]
Ссылки http://dubrovinlab.msu.ru/files/Alltogether.pdf -- 334.8 Кб -- 15.09.2012 Похожие документы
? ? 1.???????????????? 3 2.Реформа и инновации в сфере государственных услуг в России. 8 3.Особенности развития экономики Шэньчжэня 26 4.в условиях модификации модели роста в КНР 26 5.???????????????? 39 6.СРАВНИТЕЛЬНЫЙ ОПЫТ УЧАСТИЯ РОССИИ И КИТАЯ В ИНСТИТУТАХ ГЛОБАЛЬНОГО УПРАВЛЕНИЯ 41 7.Принципы развития межрегиональных центров подготовки кадров для государственного управления в Российской Федерации 59 8.??????????????? 74 9.Региональные особенности государственного регулирования сферы образования в РФ 82
... Department of Mathematics, . Faculty of Physics, MSU . ... Mathematical analysis 2 . Numerical Methods (A.N. Bogolyubov) . ... Asymptotic methods in nonlinear problems of mathematical physics . ... Extremal problems . ... Methods of finite differences in mathematical physics . ... 13 th Annual workshop will be organized by the of Department of Mathematics of Physics Faculty at Moscow State University , Moscow, Russia. ... Department of Mathematics, Faculty of Physics, Lomonosov MSU 2014-2016 ...
... About the Institute . ... The International Summer School "Computer Technologies of Engineering Mechanical Problems" is a program designed for University students studying different branches of mechanics and engineering. ... The Summer School is organized in the Institute of Mechanics of Lomonosov MSU. ... The tradition of the Summer School arose from the cooperation between the Institute of Mechanics of Lomonosov MSU and Chien Hsin University of Science and Technology, Taiwan ( www.uch.edu.tw ). ...