... Елена Фоменко (2 курс). ... Руководитель В. И. Буник, отдел биокинетики НИИ ФХБ им. А.Н.Белозерского МГУ. ... Руководитель А.Г. Евстафьева, отдел химии и биохимии нуклеопротеидов НИИ ФХБ им. А.Н. Белозерского МГУ. ... Руководитель Н.В. Чичкова, лаборатория молекулярной биологии гена отдела химии и биохимии нуклеопротеидов НИИ ФХБ им. А.Н. Белозерского МГУ. ... Руководитель А.Г. Евстафьева, лаборатория молекулярной биологии гена отдела химии и биохимии нуклеопротеидов НИИ ФХБ им. А.Н. Белозерского...
... История медицинского образования в МГУ . ... ;legends of cardiology and leading cardiologists on general cardiology and additional knowledge of interventional cardiology, cardiovascular imaging (echocardiography, cardiac CT, CMR, nuclear and PET scan), cardiovascular intensive care, electrophysiology and device therapy, advanced heart failure and transplantation, cardiac rehabilitation and prevention, grown-up congenital heart disease (GUCH), genetic and regenerative cell treatment of...
Данный сайт предназначен в первую очередь для студентов естественных факультетов ВУЗов и призван помочь в освоении материалов разделов "Электричество и магнетизм" и "Оптика" курса общей физики, а также раздела "Мессбауровская спектроскопия" специального курса "Физика твердого тела". ... Обновлены материалы к Главе IV (Часть 1) курса "Физические основы мессбауэровской спектроскопии" . ... Обновлены материалы к Главе III курса "Физические основы мессбауэровской спектроскопии" . ... Главная . ... 2012 . ...
. Participants . Investigations . Teleconference . Russian Version | Staff of the Project Centre | Partners . Web-design . Save the nature . Teachers' room . Training . Children papers . International collaboration . Web-design and hosting - FADR . webmaster@mail .
. Cтажировка ILL (Гренобль) для старшекурсников . Уважаемые студенты, на сайте факультета в разделе "Международная жизнь" / " Информация зарубежных партнеров" вывешена информация о возможности стажировки в The Institut Laue-Langevin (ILL), Гренобль, Франция по теме: 'Измерение пропускания ультрахолодных нейтронов (УХН) через жидкий и твердый дейтерий'. Подробнее: . http://www.phys.msu.ru/rus/international/intl-collaboration-agrmnts/docs/2016-02-10%20-%20stazhirovka%20ILL.pdf
. Skip to main content . X-COM parallel.ru . Главная . Возможности . Примеры . Дистрибутивы . Документация . Публикации . Обратная связь . О проекте . Свидетельства Роспатента ?2006611620 и ?2008614856 . Государственный контракт ?02.514.11.4035 от 18.05.2007 . љ .
... Публикации 2015 года . ... 2563496, 25 августа 2015 г. Тезисы докладов: . ... Москва: ЦИАМ им. П. И. Баранова, 2015. ... Волны в вязкоупругом слое, расположенном под слоем движущейся жидкости // Тезисы докладов VIII международной конференции 'Лаврентьевские чтения по математике, механике и физике'. ... Публикации 2014 года . ... Секция механики. 14 - 23 апреля 2014, Москва, МГУ имени М. В. Ломоносова. ... Публикации 2013 года . ... Секция механики. 15-23 апреля 2013, Москва, МГУ имени М.В.Ломоносова...
Alexandra A. Zobova . NAME: Alexandra A. Zobova . ... AFFILIATION: Associate Position, Department of Theoretical Mechanics and Mechatronics, . Faculty of Mechanics and Mathematics, . Lomonosov Moscow State University . ADDRESS: Alexandra A. Zobova , . ... Moscow State University, 2008 . ... Laboratory Training for the students of the Theoretical Mechanics and Applied Mechanics and Control Departments . Lecture Course on 'Dynamics of the Systems of Solid Bodies with Friction' . ...
Home . Database of structures of nucleic acid - protein complexes . ... List of complexes . Pfam families . SCOP families . Interaction classes . ... NPIDB . ... Information on SCOP and Pfam domains detected in protein chains is presented. ... Each family has its own web page with the list of entries that include domains of the family. ... List of SCOP domains occurred in DNA-protein and RNA-protein complexes is organized in tree-like form, according to the SCOP classification. ...
... B.V. Somov . head of the department . ... room 80 . ... senior research felow . ... research felow . ... research fellow . ... Our department performes the following most perspective studies: . Special analytical and numerical experimental investigations of the solar plasma involved in the magnetic reconnection process at the Sun. ... Head of the seminar: Prof. B.V. Somov. ... 27 September 2013 The Solar Physics Department was visited by journalists of the leading Russian TV channel "Vesti-1". ...
... MSU Chamber Orchestra . ... http://imslp.org - International Music Score Library Project . http://blankov.narod.ru - Early Music: texts, researchers, interpretators . http://www.rbsp.org/EMLinks/ - R&B Society - Early Music Links Collection . ... http://classicalmus.interspeed.net/early/index.html - Early Music WEB Ring . ... http://www.medieval.org/emfaq/ - Early Music FAQ . ... http://go.to/shumilov - Ivan Shumilov's Musici segreti , baroque notes collection (Sweden) . ...
... Alexeyev V.L., Levich A.P. A search for maximum species abundances in ecological communities under conditional diversity optimization // Bull. of Mathemat. ... 1997. ... Bendoricchio G., JЬrgensen S.E. Exergy as a goal function of ecosystems dynamic // Ecological modelling. ... 1999. ... Comolli C.J., Donohue C., Timothy J. Pseudomonas aeruginosa RoxR, a response regulator related to Rhodobacter sphaeroides PrrA, activates expression of the cyanide- insensitive terminal oxidase. ... 1995. ... 2000. ...
[
Текст
]
Ссылки http://dis.bio.msu.ru/States/Fursova_Mil'ko_levich/Spisok.pdf -- 167.3 Кб -- 03.12.2009 Похожие документы
... An extended set of observables of the nuclear quasi-free (p, d + ) reaction including the triple differential cross-section for coincidence measurements, its analyzing power in case of polarized proton beams and, also, the parameters of the polarization of the excited recoil nucleus and the produced deuteron are considered in the framework of the distorted-wave impulse approximation using the reaction 16 O(p, d + )15 N at a proton energy of 650 MeV as an example. ...
[
Текст
]
Ссылки http://np-chair.sinp.msu.ru/download/epja100510-offprints.pdf -- 426.2 Кб -- 18.03.2015 Похожие документы
... High Brightness RTM . ... Fig.1a: 70-MeV pulsed race-track microtron . Many applications require compact, inexpensive and efficient source of electron beam in energy range 10-100 MeV. ... Beam is focused by accelerating structure, which acts as RF quadrupole singlet, quadrupole triplets (12) installed at the even orbits return path and by electromagnet quadrupole singlet (9) installed at common axis. ... Fig.1b: 70-MeV RTM Schematic . ... Energy gain: 4.8 MeV / orbit . Orbits: 14 . ...
... Сарданашвили Геннадий Александрович (13.03.1950, Москва) [ www ]. ... G. Giachetta, L. Mangiarotti, G. Sardanashvily. ... G. Sardanashvily, Gravity as a Goldstone field in the Lorentz gauge theory, Phys. Lett. ... Phys. Lett. ... Math. ... G. Giachetta, L. Mangiarotti and G. Sardanashvily, Covariant Hamiltonian equations for field theory, J. Phys. A32 (1999) 6629-6642. ... G.Giachetta, L. Mangiarotti and G. Sardanashvily, On the notion of gauge symmetries of generic Lagrangian field theory, J. Math....
... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...
[
Текст
]
Ссылки http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/poster_mccmb_2011.pdf -- 225.5 Кб -- 21.07.2011 Похожие документы