... MPI: A Message-Passing Interface Standard . ... The Message Passing Interface Forum (MPIF), with participation from over 40 organizations, has been meeting since January 1993 to discuss and define a set of library interface standards for message passing. ... The goal of the Message Passing Interface, simply stated, is to develop a widely used standard for writing message-passing programs. ... Index to MPI Standard . ... Marc Snir, William Gropp, Ewing Lusk, Point-to-Point Communications . ... Центры...

Еще в разделе: (Показать все результаты (>580) - www.parallel.ru/ )

• Installing documentation | PARALLEL.RU - Информационно-аналитический центр по
• Version 1.2 of MPI | PARALLEL.RU - Информационно-аналитический центр по
• Linpack Benchmark -- Java Version

... If A is an earlier version # than B, returns 1. ... cur_idx_a+=1 else cur_tok_a= fi if [[ -n ${cur_tok_b} ]] && [[ -z ${cur_tok_b//[[:digit:]]} ]] ; then cur_idx_b+=1 [[ ${parts_b[cur_idx_b]} == . cur_idx_b +=1 else cur_tok_b = fi # done with number components? [[ -z ${ cur_tok_a } -z ${ cur_tok_b } ]] break # if a component is blank, then it is the lesser value [[ -z ${ cur_tok_a } ]] eshopts_pop return 1 [[ -z ${ cur_tok_b } ]] eshopts_pop ...

Еще в разделе: (Показать все результаты (>51435) - mirror.msu.net/ )

• http://mirror.msu.net/pub/gentoo-portage/sys-kernel/mips-sources/mips-sources-4.3.3.ebuild
• http://mirror.msu.net/pub/gentoo-portage/sys-kernel/mips-sources/mips-sources-4.2.8.ebuild
• http://mirror.msu.net/pub/gentoo-portage/dev-python/pycairo/pycairo-1.10.0-r4.ebuild

DVM-system of parallel program development . Installation guide . ... 1 DVM-system installation under Windows95/NT . ... Microsoft Visual C++ 5.0 version and later (4.0 version can be used with some restrictions, see below); . ... Now the user should copy all files from directory dvm_sys/user to his own directory with DVM programs. ... In this case (but if DVM-system installation was succesfully verified) the user should keep above files with errors and ask for system programmer support. ...

Еще в разделе: (Показать все результаты (>143) - sp.cs.msu.ru/ )

• DVM-system. Installation guide. Version 3.82
• DVM-system. Installation guide. Version 3.15
• DVM-system. Installation guide. Version 3.60

This page is in KOI-8 encoding . 2D inversion results for the VES field data obtained near Sevastoplol (the Ukraine) with the . ... The objective of the survey was to study the lambstone massif (the right-hand part of the cross-section) embedded in the litified clays (the central and the left-hand part of the cross-section). ... According to the geological data, it is likely that the lambstone block forms the landslide body slipping over the water-saturated litified clays. ...

Еще в разделе: (Показать все результаты (>93) - geophys.geol.msu.ru/ )

• TRF_2d. Page 3.
• Software for resistivity and induced polarization
• TRF_2d. Page2

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>28) - mouse.genebee.msu.ru/ )

• Nhunt: program for nucleic acid sequence similarity search

Next: Acknowledgements Up: World Wide Web version Previous: Page contents . ... Part of the table and a cartoon figure of the track calculated for the default set of the initial parameters are shown in Fig. 1 and 2. In the future, we intend to made available calculations of a large number of binary systems assuming different intial distributions, chemical composition, etc., to construct a "Galaxy at will", as well as various interface facilities. ... Fri Jun 21 19:17:07 MSD 1996 ...

Еще в разделе: (Показать все результаты (>767) - xray.sai.msu.ru/ )

• World Wide Web version
• Dynamics of Bianchi IX ...
• Concluding Remarks and Future Prospects

... One of the project objectives was to investigate practical efficiency of some modern iterative methods, including multigrid techniques and domain decomposition methods as well as methods for small compressible materials. ... Hence, the project research initiated because of INTAS financial support contributes in setting up modern computational techniques in tire design. ... Research on efficiency of iterative methods was conducted at the department of Mechanics of Composites about ten years ago. ...

Еще в разделе: (Показать все результаты (>3) - composite.msu.ru/ )

• INTAS 95-525 Project Main Page

... Formulation of the problem ­ angle about the mass center C IC = mR 2 ­ central moment of inertia m and R ­ mass and radius of the hula-hoop k ­ coefficient of viscous friction r ­ radius of the waist FT ­ friction force N ­ reaction force ­ angle between x and CO x = a sin t , IC m m Ё +k (R - (R - y = b cos t = -FT R r ) = m (x sin + y cos ) + FT Ё Ё Ё r ) 2 = m (x cos - y sin ) + N Ё Ё (R - r ) = R ­ non-slippage where constants 0 mod 2 are defined from + µ cos 0 = 0. ...

Еще в разделе: (Показать все результаты (>13) - belyakov.imec.msu.ru/ )

Home . Database of structures of nucleic acid - protein complexes . ... List of complexes . Pfam families . SCOP families . Interaction classes . ... NPIDB . ... Information on SCOP and Pfam domains detected in protein chains is presented. ... Each family has its own web page with the list of entries that include domains of the family. ... List of SCOP domains occurred in DNA-protein and RNA-protein complexes is organized in tree-like form, according to the SCOP classification. ...

Еще в разделе: (Показать все результаты (>19) - npidb.belozersky.msu.ru/ )

• NPIDB: List of complexes

... For those who is interested in thermodynamic modeling . Yuri Shvarov . This page is aimed mainly at the users of the software package HCh for thermodynamic (equilibrium) modeling of (geo)chemical systems and processes. However, some files presented here may also be of some interest to those who do not use HCh. ... HCh for DOS . ... User's guide for the Unitherm program intended for maintaining thermodynamic databases and calculation of thermodynamic properties of substances . ...

Еще в разделе: (Показать все результаты (>136) - www.geol.msu.ru/ )

• Faculty of Geology >> Departments
• Software for resistivity and induced polarization
• Faculty of Geology >> Geology at Moscow State University

Welcome to K -corrections calculator, simple service allowing one to determine K -corrections of a galaxy, given its redshift and one or more colours. ... Please note that galaxy redshift should stay in the range between 0.0 and 0.5. ... K -correction in choose filter.. AB mag --- SDSS u SDSS g SDSS r SDSS i SDSS z UKIDSS Y UKIDSS J UKIDSS H UKIDSS K --- Vega mag --- Johnson U Johnson B Johnson V Cousins Rc Cousins Ic 2MASS J 2MASS H 2MASS Ks . Redshift . Colour choose colour.. ...

Еще в разделе: (Показать все результаты (>9) - kcor.sai.msu.ru/ )

... The main field of my investigations is stellar spectrophotometry. As a result of scientific activity of our group spectrophotometric catalog was created including energy distribution data on 900 stars in the range 3200-7600AA and 250 stars in the range 6000-10800AA (Voloshina et al., Spectrophotometry of Bright Stars, ed. I.N.Glushneva, 1982, Moscow, Nauka, in Russian). ...

Еще в разделе: (Показать все результаты (>30) - uranus.sai.msu.ru/ )

• Eugene Trunkovsky
• Tatjana Khruzina
• Anatol Cherepashchuk

Tatiana V. Amotchkina, Michael K. Trubetskov, Vladimir Pervak, Boris Romanov, and Alexander V. Tikhonravov, "On the reliability of reverse engineering results," Appl. Opt. 51, 5543-5551 (2012) . Determination of actual parameters of manufactured optical coatings (reverse engineering of optical coatings) provides feedback to the design-production chain and thus plays an important role in raising the quality of optical coatings production. ...

Еще в разделе: (Показать все результаты (>142) - srcc.msu.ru/ )

• Alexander V. Tikhonravov, Tatiana V. Amotchkina, Michael K. Trubetskov, Robert

New GCVS Versions for Three Southern Constellations Peremennye Zvezdy (Variable Stars) 27, No. ... We are currently working on a version of the General Catalogue of Variable Stars (GCVS) revised taking into account the new data accumulated since the 4th GCVS edition. ... It will contain all stars of the 4th GCVS edition plus a complete catalogue of the stars added to the GCVS in the Name Lists of Variable Stars Nos. ...

Еще в разделе: (Показать все результаты (>106) - sai.msu.ru/ )

• General Catalogue of Variable Stars: What's new.

. Bulk of the information is in the Russian version . Go there if you can read Russian . General Information . Personalia . Science and Publications . Uralian Expedition . Crimean Student Practice . Uralian Student Practice . Software , Miscelaneous Informationx . Photoalbums . Address any question to and@geol.msu.ru

Еще в разделе: (Показать все результаты (>23) - sbmg.geol.msu.ru/ )

• Кафедра: главная страница

... USE OF A NEW VERSION OF COMAGMAT TO MODEL SULPHIDES IN GABBRONORITIC MELTS AND OL CUMULUS PILES Alexey Ariskin Kirill Bychkov 1 2 2 Leonid Danyushevsky Galina Barmina 1 1. ... CODES, University of Tasmania In an accompanying paper we presented a new version of the COMAGMAT magma crystallization model [1-3] allowing one to model various sulfide-silicate assemblages [2] and the effect of NiO content in the melt on SCSS, silicate minerals and sulphide compositions [3]. ... 4] Ariskin et al. ...

Еще в разделе: (Показать все результаты (>596) - geo.web.ru/ )

• Tomographic Models
• Harvard Seismology: 3-D Earth Structure
• COMAGMAT MODEL

. Russian version . About the Center . Publications . Workshops . Databases (in Russian) . Send Your remarks by email

Еще в разделе: (Показать все результаты (>193) - hist.msu.ru/ )

• Web-ресурсы по экономической истории
• Moscow State University. Faculty of History

English version] [Pyc.- ... The laboratory was founded in 1991, when Cellulase Research Group at the Division of Chemical Enzymology, M.V.Lomonosov Moscow State University, received the status of laboratory. From the moment of establishment of the Division of Chemical Enzymology in 1974 by Professor Ilya Berezin, Cellulase Research Group was led by Dr. Anatole Klyosov. ... Enzymology, biochemistry and biotechnology of enzymes catalyzing the biodegradation of polysaccharides: . ...

Еще в разделе: (Показать все результаты (>158) - www.enzyme.chem.msu.ru/ )

• Cellulase lab Russian version
• PubMed medline query
• Entrez-PubMed

Previous article . Next article . ... The ChromatoMod Program for the Retention Simulation in the Reversed-Phased Ion Pair HPLC . Abstract The software “ChromatoMod” for treatment of chromatographic data and modeling retention in the ion pair reversed-phased HPLC was developed. ... Moscow University Chemistry Bulletin . 2004, Vol. ... Copyright (C) Chemistry Dept., Moscow State University, 2002 . ... Copyright (C) Chemisty Department of Moscow State University . ...

Еще в разделе: (Показать все результаты (>1169) - chem.msu.ru/ )

• Mechanistic study of aniline methylation over acidic and basic zeolites Y
• Moscow University Chemistry Bulletin Vol. 48, No. 4, P. 265 (2007)
• Moscow University Chemistry Bulletin Vol. 53, No. 6, P. 369 (2012)

... BLAST (Basic Local Alignment Search Tool) is a set of similarity search programs designed to explore all of the available sequence databases regardless of whether the query is protein or DNA. ... The BLAST 2.0 search engine has been designed for optimal speed and sensitivity. ... Gapped BLAST and PSI-BLAST are useful search tools provided by the BLAST server (version 2.0) (Altschul et al., ... You can download blastcl3 form the anonymous FTP location ftp://ncbi.nlm.nih.gov/blast/network/netblast/ . ...

Еще в разделе: (Показать все результаты (>230) - www.genebee.msu.ru/ )

• Laboratory of protein-nucleic interactions (Russian version)
• BLAST 2.0 Release Notes
• BLAST Frequently Asked Questions (FAQ)