... Proceedings 2009 . Proceedings 2008 . ... Proceedings 2004 . ... The laboratory practical work is an integral part of any physical course. ... In this connection, usage of the laboratory practical work organized via a computer and information technologies is expedient. The computer allows modeling the process of carrying out experiment practically of any area of physics and makes teaching methods more visual. In the current paper the alternative of a computer practical work is offered. ...

Еще в разделе: (Показать все результаты (>365) - www.mce.biophys.msu.ru/ )

• Books : Enqlish for Computer Science Students
• Automated training systems TCM and TNM for support of rates of computer
• The applied aspects of linear algebra on the higher mathematics computer

DESCRIPTION OF THE TIME PROFILES OF KEY GEOMAGNETIC AND SOLAR WIND PARAMETERS . Time profiles of key geomagnetic parameters ( Ap and Dst indices) are shown together with key parameters of the solar wind (velocity V , density n and temperature T ) and IMF ( B , Bx , By , Bz in GSM coordinate system). ... High time resolution data on the solar wind plasma is obtained from Wind experiment in 1997 and ACE experiment in 1998-2002 using ISTP data base . ...

Еще в разделе: (Показать все результаты (>26) - dbserv.sinp.msu.ru/ )

Simulation of life inside Petri dish, where hypothetic unicellular organisms move and reproduce. ... They can't be changed while simulation is in progress Number of cells [1-10] - number of cells in dish at start of simulation Diameter of Petri dish [100-500] - defines the size of Petri dish Cell's lifetime [1-1000] - defines period of cell's life in dish Asexual(sexual) reproduction (on/off) - activates or disables chosen type of reproduction When you press "Submit" button, simulation is launched. ...

Еще в разделе: (Показать все результаты (>1514) - kodomo.cmm.msu.ru/ )

• petri_dish: 97768e4bbe61 about.html
• Genebee DotHelix Motifs' Collection Map

... Speech Recognition Engine 2.0 is a Windows-9x based computer program, allowing a User to utilize a multi-sensor setup consisting of several acoustic microphones, breath-sensor and lips movement detection sensor. ... The User can simply produce new spectral parameters dynamically calculated and saved in special cycled buffers called "channels". ... It is possible to produce special "speech detection" spectral channels using "speech detection" unary operation. ...

Еще в разделе: (Показать все результаты (>131) - www.intsys.msu.ru/ )

• Intelligent Systems :: Research :: Computer Teacher
• Intelligent Systems :: Research :: :: Research
• Intelligent Systems :: Research :: :: Articles

... DSP board program forms all driving signals for DAC-ADC electronics and stepper motor controller. ... Driving signals formation is defined by scanning regime and by feedback parameters. ... Afterwards values of measured signal and feedback signal go to a computer for further analysis. The fact that feedback loop is closed on signal processor and computer doesn't participate in feedback signal evaluation allow to make feedback more stable and independent from computer work. ...

Еще в разделе: (Показать все результаты (>128) - www.spm.genebee.msu.ru/ )

• Oscilloscope tab
• Client
• Scan parameters

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>13) - mouse.genebee.msu.ru/ )

• Nhunt: program for nucleic acid sequence similarity search

... Computer Phys. Comm , Computer Physics Communication . ... в журнале Computer Physics Communications , издательство Elsevier BV (Netherlands) , том 198, с. 12-21 DOI . ... Yurchenko Sergei N., Lodi Lorenzo, Tennyson Jonathan, Stolyarov Andrey V. в журнале Computer Physics Communications , издательство Elsevier BV (Netherlands) , том 202, с. 262-275 DOI . ... Smirnov Alexander V. в журнале Computer Physics Communications , издательство Elsevier BV (Netherlands) , том 189, с. 182-191 DOI . ...

Еще в разделе: (Показать все результаты (>4679) - istina.msu.ru/ )

• Computers and Graphics - журнал | ИСТИНА - Интеллектуальная Система
• Mathematics and Computers in Simulation - журнал | ИСТИНА - Интеллектуальная
• Computers and Composition - журнал | ИСТИНА - Интеллектуальная Система

... 119991, Moscow, GSP-1, Leninskiye Gory, MSU, 2nd Educational Building, CMC Faculty, rooms 590, 591 (Head of the laboratory), 62 . The Laboratory was established in 2001 to provide teaching and research in mathematical foundations of cryptography, cryptoanalysis, information and software security. ... The Laboratory of Mathematical Problems of Computer Security is performing a thorough research on mathematical problems in cryptoanalysis, information security, and program verification. ...

Еще в разделе: (Показать все результаты (>163) - en.cs.msu.ru/ )

• Laboratory of Mathematical Problems of Computer Security
• The Computer Systems Laboratory | CMC MSU
• Laboratory of Computer Engineering | CMC MSU

... I implementation in which the 3rd level parameter. Crocker implies in RFC 123 is given to the 3rd level programs and may specify values of the byte size to the Byte size parameter now can conceive of an programs never see this that control of this parameter that both sender and receiver the NCP. ... Buffer | ... We may allow 3rd level programs to specify a library or user supplied routine to perform the Postel [Page 1] RFC 128 Bytes April 1971 transformation between sender and receiver bytes. ...

Еще в разделе: (Показать все результаты (>15518) - mirror.msu.net/ )

• http://mirror.msu.net/pub/rfc-editor/rfc-ed-all/rfc128.txt
• http://mirror.msu.net/pub/rfc-editor/rfc-ed-all/pdfrfc/rfc174.txt.pdf
• http://mirror.msu.net/pub/rfc-editor/rfc-ed-all/rfc174.txt

... DEPRON device (Dosimeter of Electrons, PROtons and Neutrons) is intended for the measurements of  the absorbed doses and linear energy transfer spectra from high-energy electrons, protons and nuclei of space radiation, and for detecting of thermal and slow neutrons flux. ... Charged particles dosimeter based on semiconductor detector . ... For each detected particle an amplitude of impulse proportional to the energy lost by the particle in the detector?s track sensitive volume is registered. ...

Еще в разделе: (Показать все результаты (>59) - lomonosov.sinp.msu.ru/ )

• ELFIN-L | Университетский спутник "Ломоносов"
• Information unit (BI) | Университетский спутник "Ломоносов"
• TUS | Университетский спутник "Ломоносов"

... If you have already selected the main program routines during a previous work (pressure, redox conditions, crystal increment, water content, etc.) it is more convinient to cancel running the "comenu.exe" program and make changes in the program variables using the Editor Manager "comed.exe" (see Section 3.4). ... To exit the "comenu.exe" program with saving the current screen image to the data file "mainmenu.dat" one should press the 2. ... Example of "Intrus.Dat" file from the installation program 6...

Еще в разделе: (Показать все результаты (>996) - geo.web.ru/ )

• Trusov Sergey's homepage The influence of boundary layer effects on the melt
• The influence of boundary layer effects on the melt inclusions compositions.
• COMAGMAT MODEL

... PhDi . ... SOFTWARE PACKAGE FOR CALCULATIONS OF PHASE DIAGRAMS . elaborated and developed by laboratory scientists) . The software package contains a database of thermodynamic properties for about 200 systems and a software based on a so called convex hulls approach. ... binary systems in coordinates Temperature - Composition at fixed pressure and Pressure ? ... Colloquium on 24.12.12 20 Dec 2012 . ... Colloquium on 23.11.12 22 Nov 2012 . ... Laboratory of Chemical Thermodynamics . ...

Еще в разделе: (Показать все результаты (>28) - td.chem.msu.ru/ )

THE PARAMETERS INVOLVED IN HAPKE'S MODEL FOR ESTIMATION OF THE COMPOSITION OF THE EJECTA LUNAR TERRAINS. ... In the previous papers we were estimated the surface roughness of the ejecta lunar terrains by means comparison of the local phase function and the average integrated lunar indicatrix. ... The Hapke's theoretical model of the lunar surface reflection. ... For THE PARAMETERS INVOLVED IN HAPKE'S MODEL: S.G. Pugacheva, V.V. Shevchenko a low-albedo lunar surface parameter Bo = 1. ...

Еще в разделе: (Показать все результаты (>90) - selena.sai.msu.ru/ )

• http://selena.sai.msu.ru/Pug/Publications/m44_70_pugacheva.pdf
• Svetlana G. Pugacheva

... DEVELOPMENT OF EXPLICIT CYCLIC SCHEMES . WITH CHEBYSHEV?S POLYNOMIALS FOR SPACE NEUTRON KINETICS . ... Questions have been studied to use effectively explicit schemes for solving spatial kinetics. ... Algorithms have been developed to solve spatial kinetic equations on the basis of explicit cyclic schemes with time varying steps designed by V.I. Lebedev [1] as well as schemes of local iterations proposed by O.V. Lokutsievskiy and V.O. Lokutsievskiy [2]. ... Code development. ...

Еще в разделе: (Показать все результаты (>162) - sp.cs.msu.ru/ )

• DVM-system. Goals and structure
• Prefictor of DVM-program performance. User's guide
• Prefictor of DVM-program performance. Preliminary design

... In the example above, if CONDITION evaluates to TRUE, then THEN will be included in the topic; otherwise ELSE will be included. Changed: . ... The best way to use this feature is to define two TWikiVariables , one for the THEN case and the other for the ELSE case. ... IF{"context authenticated and defined WIKINAME and $ WIKINAME='FredBloggs'" then="%LI%" else="%LO%"}% . ... defined' | ... atom ::= context identifier, TWiki variable name, single-quoted string . ... TWiki variable defined or not . ...

Еще в разделе: (Показать все результаты (>37217) - dualopt1.cmm.msu.ru/ )

• IfStatements - TWiki - TWiki - (printable)
• %TOPICTITLE% (5 vs. 6) - TWiki
• IfStatements - TWiki - TWiki

A method for model comparison based on the parameter sensitivity measures Ekaterina Myasnikova Peter the Great St.Petersburg Polytechnical University, 29 Politekhnicheskaya , 195251, St.Petersburg, Russia, e-mail: myasnikova@spbcas.ru Alexander Spirov Sechenov Institute of Evolutionary Physiology and Biochemistry, 44 Toreza, 194223, St. Petersburg, Russia, Computer Science and CEWIT, State University of New York Stony Brook, Stony Brook, NY, USA e-mail: alexander.spirov@gmail.com Introduction. ...

Еще в разделе: (Показать все результаты (>211) - mccmb.belozersky.msu.ru/ )

• http://mccmb.belozersky.msu.ru/2013/abstracts/abstracts/31.pdf
• http://mccmb.belozersky.msu.ru/2013/abstracts/abstracts/26.pdf
• http://mccmb.belozersky.msu.ru/2015/proceedings/abstracts/79.pdf

О кафедре . Сотрудники . ... Публикуем материалы сотрудников кафедры . ... Кафедра математических и компьютерных методов анализа создана приказом ректора МГУ в 2008 году. ... Сотрудники кафедры проводят научные исследования в следующих областях: аналитическая теория чисел, математический анализ, теоретико-числовые методы в криптографии, сложность вычислений, компьютерная криптография, компьютерная геофизика. ... 2016, Кафедра математических и компьютерных методов анализа. ...

Еще в разделе: (Показать все результаты (>2) - mkma.math.msu.su/ )

The main purpose of the new MCQDPT2 code is to speed up calculations in the cases of medium to large basis sets and medium to large active spaces using resolvent fitting (aka table-driven) approach. ... In the latter cases it is recommended to use the default PC GAMESS/Firefly' MCQDPT2 code. ... P2P Parallel Mode Communication Interface, Dynamic Load Balancing, and large-scale MP2 Energy code . New MP2 gradient code documentation . PC GAMESS/Firefly' NBO code . ...

Еще в разделе: (Показать все результаты (>79) - classic.chem.msu.su/ )

• PC GAMESS/Firefly DOCUMENTATION - running in parallel under Windows using

International Laser Center of MSU . ... Scientific Laboratories . Science . ... 15:00 S.A. Akhmanov Hall, Nonlinear Optics Bld. ... Home Science and education Scientific Laboratories Laboratory of computer simulations in optics . ... Dergachev Aleksandr Aleksandrovich Ph.D. Dormidonov Aleksandr Evgen'evich Ph.D. Kandidov Valeriy Petrovich Doctor of science . ... Femtosecond Nonlinear Optics of High Power Laser Radiation . Femtosecond TW Laser Pulse Filamentation in Gases and Condensed Media . ...

Еще в разделе: (Показать все результаты (>109) - ilc.phys.msu.ru/ )

• "Computers and measurements" practical course laboratory

... MPI_Scan . ... starting address of send buffer (choice) . ... All MPI routines in Fortran (except for MPI_WTIME and MPI_WTICK ) have an additional argument ierr at the end of the argument list. ierr is an integer and has the same meaning as the return value of the routine in C. In Fortran, MPI routines are subroutines, and are invoked with the call statement. ... The reduction functions ( MPI_Op ) do not return an error value. ... MPI_ERR_BUFFER . Invalid buffer pointer. ... Центры . ...

Еще в разделе: (Показать все результаты (>590) - www.parallel.ru/ )

• MPE_Decomp1d | PARALLEL.RU - Информационно-аналитический центр по параллельным
• Querying File Parameters | PARALLEL.RU - Информационно-аналитический центр по
• MPE_Open_graphics | PARALLEL.RU - Информационно-аналитический центр по