... DEVELOPMENT OF EXPLICIT CYCLIC SCHEMES . WITH CHEBYSHEV?S POLYNOMIALS FOR SPACE NEUTRON KINETICS . ... Questions have been studied to use effectively explicit schemes for solving spatial kinetics. ... Algorithms have been developed to solve spatial kinetic equations on the basis of explicit cyclic schemes with time varying steps designed by V.I. Lebedev [1] as well as schemes of local iterations proposed by O.V. Lokutsievskiy and V.O. Lokutsievskiy [2]. ... Code development. ...

Еще в разделе: (Показать все результаты (>169) - sp.cs.msu.ru/ )

• DVM-system. Goals and structure
• Prefictor of DVM-program performance. User's guide
• Development of portable program system

... Лекторий по физике . ... Главная / О факультете / Подразделения факультета / Отделения и кафедры / Кафедра компьютерных методов в физике . ... Методы анализа и интерпретации эксперимента . Математические методы анализа и интерпретации эксперимента разрабатывались на кафедре под руководством проф. Пытьева Ю.П. более 25 лет. ... Методы позволяют эффективно учитывать симметрию решаемой задачи анализа и интерпретации, а также трудно формализуемые сведения о моделируемых объектах и явлениях. ...

Еще в разделе: (Показать все результаты (>395) - phys.msu.ru/ )

... Voronov, Vasiliy. Scalability and efficiency of parallel power grid simulations on massively-parallel platforms (submitted). ... 2009. ... Voronov, Vasiliy and Popova, Nina. ... Conference proceedings 2010. ... Abstract Book of SIAM Conference on Parallel Processing for Scientific Computing (SIAM PP10). ... Proceedings of the International Conference on Parallel Computing (ParCo-2009). ... IEEE Computer Press. ... Pozdneev, Alexander and Popova, Nina and Voronov, Vasiliy. ...

Еще в разделе: (Показать все результаты (>5) - angel.cmc.msu.ru/ )

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>17) - mouse.genebee.msu.ru/ )

• Nhunt: program for nucleic acid sequence similarity search

... Practical courses . ... The architecture of data acquisition and control systems systems and laboratory works employs various types of plug-in boards, CAMAC modules, GPIB boards, original connecting cards and virtual generators, breadboard modules, and sound blasters, which are used as generators of analog signals of different shapes and as analog-to-digital converters. ... Pascal and C++ are employed to program the different blocks of data acquisition and control systems systems. ...

Еще в разделе: (Показать все результаты (>694) - ilc.phys.msu.ru/ )

• Practice
• Laboratory of computer simulations in optics
• Grants

... Пользователи -General- Common Current University Society Study Diaspora FAQ Real Estate -Technical- Development Hard&Soft Network Mobile -Market- Market Services Job -Hobby- Behemoth Health Love&Sex Еда Media Games Auto&Moto Sport Hobby Flood Zone -Servant- Alternative Forums Forum -Garbage- Revolution Garbage Private . ... Программист-математик, computer vision, от 70к . ... Re: Программист-математик, computer vision, от 70к [ re: nelenivy ] . ...

Еще в разделе: (Показать все результаты (>2060) - www.fds-net.ru/ )

• Необходима помощь: Read-Only DC и присоединение компов к домену. - Public forum
• computer ID - Public forum of MSU united student networks
• How to know Computer Browser service is runing on some computer? - Public forum

Home People Activities Research Publications . ... Containers for image storage in memory, reading and writing of image files, Pipeline filtering library, D.Yurin "On the Images Pipe Line Filtering, PDF , color spaces, fast convolutions, image registration algorithms, edge curvature estimation via differential invariants (under development) , Bresenham algorithms, some numerical algorithms etc. ... Download help on project (CHM) , generated via doxygen (see How to document program's code ) . ...

Еще в разделе: (Показать все результаты (>20) - imaging.cs.msu.ru/ )

... DSP board program forms all driving signals for DAC-ADC electronics and stepper motor controller. ... Driving signals formation is defined by scanning regime and by feedback parameters. ... Afterwards values of measured signal and feedback signal go to a computer for further analysis. The fact that feedback loop is closed on signal processor and computer doesn't participate in feedback signal evaluation allow to make feedback more stable and independent from computer work. ...

Еще в разделе: (Показать все результаты (>137) - www.spm.genebee.msu.ru/ )

• Client
• Oscilloscope tab
• Scan parameters

О кафедре . Сотрудники . ... Публикуем материалы сотрудников кафедры . ... Кафедра математических и компьютерных методов анализа создана приказом ректора МГУ в 2008 году. ... Сотрудники кафедры проводят научные исследования в следующих областях: аналитическая теория чисел, математический анализ, теоретико-числовые методы в криптографии, сложность вычислений, компьютерная криптография, компьютерная геофизика. ... 2016, Кафедра математических и компьютерных методов анализа. ...

Еще в разделе: (Показать все результаты (>2) - mkma.math.msu.su/ )

Алексеевский Андрей Владимирович . ... Миронов Андрей Александрович . ... Тем не менее, посещение страницы "Тьюторы ФББ" может быть полезным для выбора тьютора . ... Для студентов 1-го курса: Можно начать поиски тьютора уже сейчас! ... Активность в выборе темы и руководителя - за студентом. Студент выбирает руководителя и тему, просит руководителя взять его на данную тему. ... Студент сообщает о договоренности (фамилии студента и тьютора, название темы) Л.А.Зиновкиной . ...

Еще в разделе: (Показать все результаты (>1695) - kodomo.cmm.msu.ru/ )

• Petri dish
• GeneBee service result

Prediction of physical properties of materials based only on their chemical composition has long been an intriguing task. ... The main interests of Prof. Lebedev 's group are physical properties of crystals exhibiting structural instability, in which different phase transitions (including the ferroelectric one) can appear. ... A.I. Lebedev. ... Physics of the Solid State 51 , 362 (2009) ; e-print arXiv:1305.0240 (2013) ; [local copy] . ... Physics of the Solid State 51 , 2324 (2009) ; [local copy] . ...

Еще в разделе: (Показать все результаты (>87) - scon155.phys.msu.su/ )

• A new method for determining parameters of the potential well of off-center
• New methods of measuring photoelectric parameters of silicon

... Two computers in the same network are usually linked via a single physical cable. When they communicate over the network, the programs in each computer that take part in the communication are linked via a virtual connection , a sort of imaginary cable. ... When it notices an incoming network login (i.e., it notices that it gets a new virtual connection to some other computer), it starts a new process to handle that single login. ... What login does ...

Еще в разделе: (Показать все результаты (>345) - itpm.msu.su/ )

• All About ifconfig
• Typically Used sendmail.m4 Parameters
• Another Example

MOSCOW STATE UNIVERSITY -- Faculty of Biology -- Department of Human Physiology -- . ... Our interest is the secret springs of work of a brain. How can a new idea be born in the brain if the physical environment remains constant? ... What mechanisms of the brain are broken in schizophrenia? ... For this purpose we create brain-computer interfaces (BCI) based on modern methods of computational electroencephalography. ... Department of Human Physiology . ... Former Visitors . ... Former students . ...

Еще в разделе: (Показать все результаты (>76) - brain.bio.msu.ru/ )

• Sergei Shishkin * Сергей Шишкин
• Alexander Zhigalov
• BCI ALBUM | INTERESTING PEOPLE

... Полная версия этой страницы: Работа в Samsung . Студенческий форум Физфака МГУ > Общий > Работа . ... Telecommunication Network . ... Job Summary: The Optical Engineer will be involved in the design, fabrication and testing of optical/digital imaging system for mobile devices. ... Required Skills: Must have proven optical design and algorithm skills, lens design experience using code-V or equivalent lens design software. ... Company: Samsung Electronics Telecommunication Network Business . ...

Еще в разделе: (Показать все результаты (>400) - wasp.phys.msu.ru/ )

• Работа в Samsung - Студенческий форум Физфака МГУ
• Студенческий форум Физфака МГУ > M.Cs. in computer science and electronics

Evolution as a hard combinatorial problem D. Grigoriev, CNRS, UniversitЄ de Lille, dmitry.grigoryev@math.univ-lille1.fr e J.Reinitz, Dept.of Statistics, Chicago University, reinitz@galton.uchicago.edu S. Vakulenko, Institute for Mechanical Engineering Problems, Saint Petersburg, vakulenfr@mail.ru A. Weber, Computer Science Department, University of Bonn, weber@cs.uni-bonn.de We consider complexity emergence problem and formation of complex organs. ... The number n >> 1 is the gene number. ...

Еще в разделе: (Показать все результаты (>251) - mccmb.belozersky.msu.ru/ )

• http://mccmb.belozersky.msu.ru/2015/proceedings/abstracts/16.pdf
• http://mccmb.belozersky.msu.ru/2015/proceedings/abstracts/35.pdf
• http://mccmb.belozersky.msu.ru/2013/abstracts/abstracts/26.pdf

... PhDi . ... SOFTWARE PACKAGE FOR CALCULATIONS OF PHASE DIAGRAMS . elaborated and developed by laboratory scientists) . The software package contains a database of thermodynamic properties for about 200 systems and a software based on a so called convex hulls approach. ... binary systems in coordinates Temperature - Composition at fixed pressure and Pressure ? ... Colloquium on 24.12.12 20 Dec 2012 . ... Colloquium on 23.11.12 22 Nov 2012 . ... Laboratory of Chemical Thermodynamics . ...

Еще в разделе: (Показать все результаты (>20) - td.chem.msu.ru/ )

Mikushin, D.N., and V.M. Stepanenko. The implementation of regional atmospheric model numerical algorithms for CBEA-based clusters. Lecture Notes in Computer Science, Parallel Processing and Applied Mathematics, Vol. 6067, 2010, p. 525-534. ... Target ing the next generation of MPI-CellBE hybrid cluster architectures, out method aims to provide additional scalability to MPI-based codes of atmospheric models and related applications . ...

Еще в разделе: (Показать все результаты (>195) - srcc.msu.ru/ )

• A. Goncharsky. Some problems of computer tomography in wave approximation. //
• Oseledets I.V., Tyrtyshnikov E.E. Algebraic wavelet transform via quantics
• Sulimov Vladimir CV

... I implementation in which the 3rd level parameter. Crocker implies in RFC 123 is given to the 3rd level programs and may specify values of the byte size to the Byte size parameter now can conceive of an programs never see this that control of this parameter that both sender and receiver the NCP. ... Buffer | ... We may allow 3rd level programs to specify a library or user supplied routine to perform the Postel [Page 1] RFC 128 Bytes April 1971 transformation between sender and receiver bytes. ...

Еще в разделе: (Показать все результаты (>26699) - mirror.msu.net/ )

• http://mirror.msu.net/pub/rfc-editor/rfc-ed-all/rfc128.txt
• http://mirror.msu.net/pub/rfc-editor/rfc-ed-all/rfc371.txt
• http://mirror.msu.net/pub/rfc-editor/rfc-ed-all/pdfrfc/rfc371.txt.pdf

... E. Huhlaev, Metamake Tools for Personal Project Preparation in Heterogeneous Network Environment (ID=260), Word doc . ... O. Kodolova, Experience with OO Database for CMS Events Distributed Between Two Sites (ID=294), PDF file . ... A. Nikitin, The GA Based Approach to Optimization of Parallel Calculations in Large Physics Problems (ID=220), Word doc . ... J. Seixas, Neural Particle Discrimination for Triggering Interesting Physics Channels Using Calorimetry Data (ID=311), PDF file . ...

Еще в разделе: (Показать все результаты (>75) - acat02.sinp.msu.ru/ )

• http://acat02.sinp.msu.ru/presentations/nikitin/posterACAT2002.doc
• http://acat02.sinp.msu.ru/page0.html
• http://acat02.sinp.msu.ru/topics.html

The main purpose of the new MCQDPT2 code is to speed up calculations in the cases of medium to large basis sets and medium to large active spaces using resolvent fitting (aka table-driven) approach. ... In the latter cases it is recommended to use the default PC GAMESS/Firefly' MCQDPT2 code. ... P2P Parallel Mode Communication Interface, Dynamic Load Balancing, and large-scale MP2 Energy code . New MP2 gradient code documentation . PC GAMESS/Firefly' NBO code . ...

Еще в разделе: (Показать все результаты (>83) - classic.chem.msu.su/ )

• Firefly/PC GAMESS DOCUMENTATION - NEW MP2 GRADIENT CODE
• PC GAMESS/Firefly DOCUMENTATION - running in parallel under Windows using