Выберите категорию обращения: Общие вопросы Отчеты Рейтинги Диссертационные советы Конкурсы Ввод данных Структура организаций Пользователи Проблемы с регистрацией\входом в систему . ... 2014 Making use of a partial order in solving inverse problems: II . ... в журнале Inverse Problems , издательство Institute of Physics Publishing (United Kingdom) , том 30, ? ... Korolev Y. , Yagola A. в журнале Inverse Problems , издательство Institute of Physics Publishing (United Kingdom) , том 29, с. 1-11 DOI . ...

Еще в разделе: (Показать все результаты (>1549) - istina.msu.ru/ )

• Kolmanovskii V.B. - сотрудник | ИСТИНА - Интеллектуальная Система Тематического
• Journal of Inverse and Ill-Posed Problems - журнал | ИСТИНА - Интеллектуальная
• Contemporary Problems of Ecology - журнал | ИСТИНА - Интеллектуальная Система

V.A. Morozov . Methods for Solving Incorrectly Posed Problems . ... В работе изложены регулярные методы решения неустойчивых линейных и нелинейных задач. ... Установлена связь этих методов. ... Поставлена проблема определения адекватности математических моделей и разработаны численные методы ее решения. Монография рекомендуется для аспирантов и научных работников, интересующихся эффективными методами решения некорректно поставленных и обратных задач математической физики и анализа. ...

Еще в разделе: (Показать все результаты (>136) - srcc.msu.ru/ )

• Laboratory of Systems for Automated Image Processing
• N.L. Gol'dman. Inverse Stefan Problems
• Laboratory of Informatics

... Problems in testing . ... The MPICH test suite, in examples/test , performs a fairly complete test of an MPI implementation. If there is an error, it usually indicates a problem with the implementation of MPI; if you encounter such a problem, please report it to mpi-bugs@mcs.anl.gov . ... Up: Problems in testing Next: Acknowledgments Previous: Problems in testing . ... Q: The test pt2pt/structf fails with . ... A: This is not an error; it is a gap in the MPI definition. ... Центры . ...

Еще в разделе: (Показать все результаты (>431) - www.parallel.ru/ )

• New Datatype Manipulation Functions | PARALLEL.RU - Информационно-аналитический
• Submitting bug reports | PARALLEL.RU - Информационно-аналитический центр по
• Problems configuring | PARALLEL.RU - Информационно-аналитический центр по

The database of RNA secondary structure elements E.F. Baulin, Institute of Mathematical Problems in Biology, Pushchino, Russia, Higher Schoo l of Economics, Moscow, Russia ... Russia, Higher Schoo l of Economics, Moscow, Russia, mroytberg@lpm.org.ru We propose a new definition of the loop, which on the one hand is a generalization of the definition of Mathews-Turner [1], and on the other hand allows to divide into loops an arbitrary secondary ...

Еще в разделе: (Показать все результаты (>231) - mccmb.belozersky.msu.ru/ )

• http://mccmb.belozersky.msu.ru/2013/abstracts/abstracts/107.pdf
• http://mccmb.belozersky.msu.ru/2013/abstracts/abstracts/178.pdf
• http://mccmb.belozersky.msu.ru/2013/abstracts/abstracts/194.pdf

... Scientific conference . ... International recognition of this outstanding woman and scientist serves as a wonderful example for the young people who have chosen chemistry as the basis for the carrier, and makes it possible to commemorate the important contribution of women in the development of chemistry as a science.  ... Especially in Russia women received possibility of professional realization in chemical science and education through  different ways starting from 1870’s on. ...

Еще в разделе: (Показать все результаты (>130) - www.chem.msu.ru/ )

Next: Initial conditions Up: Old neutron star distribution Previous: Introduction . The problem to be solved is to find stationary space distribution of stars which have had certain initial space and velocity distributions and move in a given potential. ... In principle, the most straightforward way to obtain the solution is to integrate directly the equations of motion for a sufficiently large number of stars with different initial conditions. ... Then space density is given by . ...

Еще в разделе: (Показать все результаты (>426) - xray.sai.msu.ru/ )

• PROBLEMS OF THEORETICAL COSMOLOGY - UISS2000
• No Title
• Be/X-ray binaries and candidates

XAFS spectroscopy is widely used in physics, materials science, chemistry (especially in catalysis and coordination chemistry), biology, geochemistry and environmental science. ... This is an interface to the Glimpse -based search engine which enables you to find published papers in different fields of x-ray absorption spectroscopy -- XAFS, EXAFS, XANES, NEXAFS, SEXAFS, XEOL, and EXAFS-like phenomena in photoemission, electron-energy-loss spectra and so on. ... Database Search Form . ...

Еще в разделе: (Показать все результаты (>3) - scon155.phys.msu.ru/ )

This page could be summarized with the statement: don't require Apache to use DNS for any parsing of the configuration files . ... In order for Apache to function properly it absolutely needs to have two pieces of information about each virtual host: the ServerName and at least one IP address that the server responds to. ... use IP addresses in Listen . ... In any event it doesn't seem possible to reliably boot a virtual-hosted web server when DNS has failed unless IP addresses are used. ...

Еще в разделе: (Показать все результаты (>418) - rtm-cs.sinp.msu.ru/ )

• Apache module mod_auth_anon.c
• The MICO Binder (CORBA Extension)
• Bridging mini-Howto

Moscow State University . INTERNATIONAL CONFERENCE . ... Moscow, Russia . ... Institute of Mechanics of MSU . ... The aim of this Conference is gathering active researchers and students in the field of nonlinear fluid dynamics in order to provide a forum for discussions. Since 1976 through 2008 the Conference was organized by the Institute of Mechanics of Moscow State University (see http://hit2003.narod.ru/ ). ... Institute of Mechanics , Moscow State University . ...

Еще в разделе: (Показать все результаты (>27) - hit-conf.imec.msu.ru/ )

... This file can be created using ''' trac -admin env deploy dir ''' command which automatically substitutes required paths. {{{ #! python import os os. environ [' TRAC _ENV'] = '/ usr / local / trac /mysite' os. environ [' PYTHON _EGG_CACHE'] = '/ usr / local / trac /mysite/eggs' import trac .web.main application = trac .web.main.dispatch_request }}} The ` TRAC _ENV` variable should naturally be the ... Using this method may lead to Trac delivering the content of another Trac environment. ...

Еще в разделе: (Показать все результаты (>1311) - kodomo.cmm.msu.ru/ )

• TracModWSGI тАУ Tanchiki
• TracTickets тАУ Tanchiki

. Название публикации . Nuclear Magnetic Resonance Spectroscopy in Solving the Analytical Problems of Medicine: Analysis of Cerebrospinal Fluid . Авторы . T.N. Kolokolova, O.Yu. Savel'ev, N.M. Sergeev, O.A. Shpigun, K.V. Sokolov, V.I. Skvortsova . Дата . 31.12.2009 23:00:00 . Название журнала . Journal of Analytical Chemistry. Том . Vol.65 . Номер . 10. первая страница . 1073 . последняя страница . 1081. Купить нет на складе . 2009 ФФМ МГУ, 2009

Еще в разделе: (Показать все результаты (>12) - fbm.msu.ru/ )

... N.5, pp.592-597 (scanned PDF file, English version) . ... A.V.Shanin, Embedding formula for electromagnetic diffraction problem // Zapiski seminarov POMI, V.324, pp.247-261 (2001), in Russian, (PDF file, Russian version) (PDF file, English version) . ... PDF file) . ... Shanin A.V., Coordinate equations for the Laplace-Beltrami problem on a sphere with a cut // QJMAM, 2005 (58) 2, 1-20 The preprint versions of two previous papers have been sent to URSI contest: Paper 1, PDF file , Paper 2, PDF file ...

Еще в разделе: (Показать все результаты (>55) - acoustics.phys.msu.ru/ )

... The applied mathematics (with Honors), Kazan State University, Kazan, Russia (USSR), 1980. nd Alexander Lazarev Research Interests Discrete optimization: combinatory problems, modeling, decomposition algorithms, applications to production planning and scheduling. ... Kazan, Publishing house of the Kazan mathematical society, 1998. - 285 p. Lazarev A.A., Gafarov E.R. Scheduling Theory. ... Computer centre of the Russian Academy of Sciences - 2006. - 134 p. Lazarev A.A., Gafarov E.R. Scheduling Theory...

Еще в разделе: (Показать все результаты (>5) - physcontrol.phys.msu.ru/ )

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>16) - mouse.genebee.msu.ru/ )

M.H. Shulman, 2006 Michael H. Shulman ON AN IMPORTANT COSMOLOGICAL PROBLEMS SOLUTION IN THE FRAME OF A NEW COSMOLOGICAL MODEL Abstract A modification of the Einstein ­ Friedmann cosmological model allows to solve a basic cosmological fundamental and observational problems, such as these ones: the vacuum energy and dark energy problems, horizon problem, flatness problem, supernovae low brightness at the high redshift (z > 1). ... New cosmological model The upper curve on the figure 2 is linear. ...

Еще в разделе: (Показать все результаты (>403) - chronos.msu.ru/ )

• The Finite and the Infinite: A New view on the problem
• Laboratory-chair of modelling the natural references of time

PHP Manual . ... If you are still stuck, someone on the PHP installation mailing list may be able to help you. ... If you want to get help on the mailing list, please try to be precise and give the necessary details about your environment (which operating system, what PHP version, what web server, if you are running PHP as CGI or a server module, etc.), and preferably enough code to make others able to reproduce and test your problem. If you think you have found a bug in PHP, please report it. ...

Еще в разделе: (Показать все результаты (>491) - oit.cmc.msu.ru/ )

• Database issues
• Persistent Database Connections
• FAQ: Frequently Asked Questions

... For those who is interested in thermodynamic modeling . Yuri Shvarov . This page is aimed mainly at the users of the software package HCh for thermodynamic (equilibrium) modeling of (geo)chemical systems and processes. However, some files presented here may also be of some interest to those who do not use HCh. ... HCh for DOS . ... User's guide for the Unitherm program intended for maintaining thermodynamic databases and calculation of thermodynamic properties of substances . ...

Еще в разделе: (Показать все результаты (>74) - www.geol.msu.ru/ )

• "Смирновский Сборник". Кафедра геологии и геохимии полезных ископаемых

... chunky_bacon : Re: Прямая трансляция Macworld [re:Demo9] 15.01.2008 20:25 | ... The www.iphonealley.com forum technical staff have been notified of the error, though you may contact them if the problem persists. ... Demo9 [re:chunky_bacon] 15.01.2008 20:29 | ... chunky_bacon [re:Demo9] 15.01.2008 21:10 | ...

Еще в разделе: (Показать все результаты (>2097) - www.fds-net.ru/ )

• Diablo2 Server Problem (to Plop) - Public forum of MSU united student networks
• SB Live problems - Public forum of MSU united student networks
• ultra problem - Public forum of MSU united student networks

... The subjects of the Colloquium-458 cover important problems dealing with the verification of constitutive equations, the organization of experiments, the connection between microstructures and mechanical properties and the effective utilization of the modern FEM packages. ... Institute of Mechanics, Lomonosov Moscow State University, Michurinsky Prospekt, 1, 117192, Moscow, Russia . ... S.-Petersburg, 195251, Russia. ... Institute for Problems in Mechanics of Russian Academy of Sciences . ...

Еще в разделе: (Показать все результаты (>3) - www.imec.msu.ru/ )

• EUROMECH Colloquium-458

THE LABORATORY OF CHEMISTRY AND PHYSICS OF SENSOR AND SEMICONDUCTOR MATERIALS . ... Reactivity thermoelectric clathrate compounds in interaction with components of the air . The project aims to address the fundamental problems of solid state chemistry - revealing the fundamental regularities of the reactivity of crystalline phases in reactions with air components and processes of formation of oxide layers (coatings) for new materials. ...

Еще в разделе: (Показать все результаты (>21) - www.lssm.inorg.chem.msu.ru/ )