... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>30) - mouse.genebee.msu.ru/ )

• Nhunt: program for nucleic acid sequence similarity search

Network Working Group G. H. Mealy Request for Comments: 195 HARV NIC 7140 16 July, 1971 Categories: D.4, D.7 Data Computers -- Data Descriptions and Access Language According to the minutes of the NWG meeting in May (RFC 164), it appears that a unified approach to Network data management is being proposed to CCA. ... Healy [Page 1] RFC 195 Data Computers July 1971 4. ... File declarations name the file and the elements in the file, and specify the range of forms that the elements can take. ...

Еще в разделе: (Показать все результаты (>22986) - mirror.msu.net/ )

• http://mirror.msu.net/pub/rfc-editor/rfc-ed-all/pdfrfc/rfc195.txt.pdf
• http://mirror.msu.net/pub/rfc-editor/rfc-ed-all/rfc480.txt
• http://mirror.msu.net/pub/rfc-editor/rfc-ed-all/pdfrfc/rfc480.txt.pdf

... THE PARALLELIZATION OF COMPUTATIONAL ALGORITHMS IN LARGE PHYSICS PROBLEMS ON MULTIPROCESSOR COMPUTER SYSTEM CONTAINING THOUSAND AND MORE OF PROCESSOR ELEMENTS REQUIRES SPECIAL TOOLS. ... THE GENETIC ALGORITHM CAN BE CHARACTERIZED BY THE FOLLOWING PARAMETERS: - coding strategy, - population size, - initialisation strategy, - selection technique, - crossover mechanism, - mutation mechanism, - strategy for offspring inclusion. ... The results are presented on the following figure. ...

Еще в разделе: (Показать все результаты (>78) - acat02.sinp.msu.ru/ )

• http://acat02.sinp.msu.ru/presentations/huhlaev/Metamake.doc
• http://acat02.sinp.msu.ru/presentations/vaiciulis/acat2002.ps
• http://acat02.sinp.msu.ru/poster-sessions.html

... Practical courses . ... The architecture of data acquisition and control systems systems and laboratory works employs various types of plug-in boards, CAMAC modules, GPIB boards, original connecting cards and virtual generators, breadboard modules, and sound blasters, which are used as generators of analog signals of different shapes and as analog-to-digital converters. ... Pascal and C++ are employed to program the different blocks of data acquisition and control systems systems. ...

Еще в разделе: (Показать все результаты (>730) - ilc.phys.msu.ru/ )

• Laboratory of computer simulations in optics
• Practice
• Laser Graduate School

... Type matching rules . Up: Data type matching and data conversion Next: Type MPI_CHARACTER Previous: Data type matching and data conversion . ... Message data . ... Communication of typed values (e.g., with datatype different from MPI_BYTE), where the datatypes of the corresponding entries in the sender program, in the send call, in the receive call and in the receiver program must all match. ... Up: Type matching rules Next: Data conversion Previous: Type matching rules . ... Центры . ...

Еще в разделе: (Показать все результаты (>859) - www.parallel.ru/ )

• mpC Tutorial | PARALLEL.RU - Информационно-аналитический центр по параллельным
• Registers and Compiler Optimizations | PARALLEL.RU -
• MPI_Scan | PARALLEL.RU - Информационно-аналитический центр по параллельным

... Войти в систему . ... в журнале Automatic Control and Computer Sciences , издательство Allerton Press Inc. ... Chemeritskii E.V. , Zakharov V.A. в журнале Automatic Control and Computer Sciences , издательство Allerton Press Inc. ... Chemeritsky E.V. , Smeliansky R.L. , Zakharov V.A. в журнале Automatic Control and Computer Sciences , издательство Allerton Press Inc. ... Подловченко Р.И. , Молчанов А.Э. в журнале Automatic Control and Computer Sciences , издательство Allerton Press Inc. ...

Еще в разделе: (Показать все результаты (>3934) - istina.msu.ru/ )

• Mathematical and Computer Modelling - журнал | ИСТИНА - Интеллектуальная
• Journal of Computer and Systems Sciences International - журнал | ИСТИНА -
• Programming and Computer Software - журнал | ИСТИНА - Интеллектуальная Система

Either several (at least two) Intel/AMD-based computers having identical or similar hardware configuration and running in the local network environment under the control of Windows NT 4.0, Windows 2000, Windows XP, Windows Server 2003, Windows Vista, Windows Server 2008, or Windows 7. ... The 32-bit NT-MPICH package (the part of MP-MPICH) must be installed, including MPI dynamic link libraries and cluster management service, on all computers to be used to run PC GAMESS/Firefly in parallel. ...

Еще в разделе: (Показать все результаты (>111) - classic.chem.msu.su/ )

• PC GAMESS/Firefly DOCUMENTATION - running in parallel under Windows using WMPI
• PC GAMESS/Firefly DOCUMENTATION - running in parallel Linux/MPICH binaries
• Lesson two: converging difficult SCF cases

... StaticMethod untaintUnchecked ( $string ) $untainted . ... StaticMethod validateWebName($name) $web . ... StaticMethod validateAttachmentName($name) $attachment . ... All calls to system functions, or handling of file names, should be brokered by the sysCommand function in this package. ... If $string is undefined, return undef. ... Returns the name, or undef if it is invalid. ... STDOUT is returned. ... This topic: System > WebHome > ReferenceManual > DeveloperDocumentationCategory > PerlDoc . ...

Еще в разделе: (Показать все результаты (>48920) - wiki.cmc.msu.ru/ )

• VarEXAMPLETAG < System < Foswiki
• VarQUERYPARAMS < System < Foswiki
• VarURLPARAM < System < Foswiki

The Apache HTTP Server provides a mechanism for storing information in named variables that are called environment variables . ... For additional flexibility, the directives provided by mod_setenvif allow environment variables to be set on a per-request basis, conditional on characteristics of particular requests. ... As discussed above, the environment passed to CGI scripts includes standard meta-information about the request in addition to any variables set within the Apache configuration. ...

Еще в разделе: (Показать все результаты (>122) - neptun.sai.msu.ru/ )

• Issues Regarding DNS and Apache
• Hints on Running a High-Performance Web Server
• Apache Tutorial: Dynamic Content with CGI

... Mathematical models and methods in VLSI design . ... General models and statements about the complexity of combinatorial tasks, methods for development of fast algorithms (method of dynamic programming, ?divide and conquer?, ?method of model extension?) are considered. ... Mathematical models of contemporary electronic circuits are considered and basic approaches to solving task of logic synthesis, as well as tasks of VLSI modules placement and interconnection routing are described. ...

Еще в разделе: (Показать все результаты (>134) - hcs.cmc.msu.ru/ )

• Master program "Mathematical Models of Complex Systems" | Магистерское и
• Master program "Mathematical and computer methods of image processing" |
• Master programљ"Decision Engineering in Economics and Finance" | Магистерское и

... UNIX commands . ... passwd command . ... changing . ... preventing prompt for . ... display to working directory . ... changing for access . ... accessing with the shift command . ... passing command arguments with . ... PostScript . files, printing . ... files . print queue . ... printer . ... printing . cancelling . ... PostScript files . ... prompt . ... display current directory in . display username in . display system name in . ...

Еще в разделе: (Показать все результаты (>478) - comet.sai.msu.ru/ )

• Special shell variables
• The case statement
• Multiwavelength Study of Mira Ceti-Type Variable Stars

... NetCDF User's Guide for C . Unidata ( http://www.unidata.ucar.edu ) is a National Science Foundation-sponsored program empowering U.S. universities, through innovative applications of computers and networks, to make the best use of atmospheric and related data for enhancing education and research. ... The Network Common Data Form (netCDF) software described in this guide was originally intended to provide a common data access method for the various Unidata applications. ...

Еще в разделе: (Показать все результаты (>187) - angel.cs.msu.su/ )

• : Class ProtoVariable
• : Class AbstractNetcdf
• : Class Schema

... Russian Pages . CDFE: Home Page . ... Numerical data, graphics, and bibliography . ... description] . Last updated: May 6th, 2014 . ... Last updated: June 15th, 2011 . ... Last updated: . ... Last updated: April 4th, 2015 . ... Last updated: February 25th, 2016 . ... Last updated: September 27th, 2011 . ... Photonuclear Data Index since 1955 . ... Last updated: September 15th, 2015 . ... Last updated: March 22th, 2010 . ... Last updated: March 19th, 2015 . ... Last updated: May 15th, 2002 . ...

Еще в разделе: (Показать все результаты (>44) - cdfe.sinp.msu.ru/ )

• CDFE => Online Services

... Practicum on polymer chemistry and physics. 4th year (autumn semester) . ... Determination of molecular mass of polymer by viscometry. ... Evaluation of elasticity modulus of polymer gels using compression method. 3 new problems for this practicum have been set up in September, 1998: . ... Molecular design of polymers and computer synthesis of polymers with desired properties (INEOS). Methods of preparation of thin organic films: . ... Frederiks transition in thin films of liquid crystals (INEOS). ...

Еще в разделе: (Показать все результаты (>316) - polly.phys.msu.ru/ )

V.I. Ivanov, M.K. Trubetskov . Handbook of Conformal Mapping with Computer-Aided Visualization . ... The book is a complete handbook on conformal mapping applications in mathematical physics. The book is supplied with IBM PC programs for Microsoft Windows for conformal mapping visualization and analysis. Conformal mappings are large and essential part of the complex analysis. ... Conformal mappings are included into all courses of studies of the complex analysis. ...

Еще в разделе: (Показать все результаты (>219) - srcc.msu.ru/ )

• A. Goncharsky. Some problems of computer tomography in wave approximation. //
• Gol'dman N. L. Inverse problems with final overdetermination for parabolic
• Laboratory of Systems for Automated Image Processing

... we show that the comparison between the calculated and observed numbers of the most ``fragile'' (from the point of view of the binary evolution scenario )   galactic binary types (such as X-ray low-mass X-ray binaries (LMXB), cataclysmic variables (CV),   Be-stars   with compact companions, relative number of visible binary radiopulsars   with normal and compact secondary components) impose certain constraints on the feasible initial ... Phenomenological Kick Velocity . ...

Еще в разделе: (Показать все результаты (>631) - xray.sai.msu.ru/ )

• Initial Distributions of Binary Parameters
• The Model
• Notes on Monte-Carlo Simulations

Series on Stability, Vibration and Control of Systems, Series A - Vol. ... MULTIPARAMETER STABILITY THEORY WITH MECHANICAL APPLICATIONS . ... This book deals with fundamental problems, concepts, and methods of multiparameter stability theory with applications in mechanics. ... Introduction to Stability Theory . ... Read Full Review . ... Since Bolotin's pioneering book on nonconservation problems on the theory of elastic stability, not many books appeared at such a high level, such as this one. ...

Еще в разделе: (Показать все результаты (>31) - mailybaev.imec.msu.ru/ )

... The applied mathematics (with Honors), Kazan State University, Kazan, Russia (USSR), 1980. nd Alexander Lazarev Research Interests Discrete optimization: combinatory problems, modeling, decomposition algorithms, applications to production planning and scheduling. ... Kazan, Publishing house of the Kazan mathematical society, 1998. - 285 p. Lazarev A.A., Gafarov E.R. Scheduling Theory. ... Computer centre of the Russian Academy of Sciences - 2006. - 134 p. Lazarev A.A., Gafarov E.R. Scheduling Theory...

Еще в разделе: (Показать все результаты (>2) - physcontrol.phys.msu.ru/ )

OPTIMIZATION WITH PENNES' BIOHEAT EQUATION AS CONSTRAINT Malek A., Abbasi GH. ... The solution of optimal control problem for the Pennes ' bioheat equation involving boundary function of continuous time variable in its energy function is proposed. ... Malek, A., Momeni-Masuleh, S.H., A mixed collocation-finite difference method for 3D microscopic heat transport problems, Journal of Computational and Applied Mathematics, Vol. ...

Еще в разделе: (Показать все результаты (>419) - www.mce.biophys.msu.ru/ )

• Calculating experiment and problems of nonlinear dynamics in computer practical
• Introduction problems of object-oriented programming in school course

Expands the parameters to the query that was used to display the page. ... encoding="entity" . encoding="safe" . ... If this parameter is not given, "safe" encoding is performed which HTML entity encodes the characters '"<>% . ... safe : Encode characters '"<>% into HTML entities. (this is the default) . ... By default QUERYPARAMS encodes the characters '"<>% into HTML entities (same as encoding="safe") which is relatively safe. ... This topic: System > WebHome > Macros > VarQUERYPARAMS . ...

Еще в разделе: (Показать все результаты (>23263) - wiki.cs.msu.ru/ )

• (backlinks in all Webs) FormatTokens < System < Foswiki
• (backlinks in System Web) FormatTokens < System < Foswiki
• (backlinks in all Webs) FormattedSearch < System < Foswiki