ATLAS Physics Prospects for 2010-2011 Victor Maleev (Petersburg Nuclear Physics Institute) on behalf of ATLAS collaboration see also Bruse Melado report Outline: · · · · · · W and Z production Early B-physics Top Higgs Exotics SUSY We assume ~50 pb-1 in 2010 and ~1 fb-1 by the end of 2011. ... 08.09.2010 QFTHEP-2010, V.Maleev 15 HZZ4l NLO Higgs to four lepton production cross-sections at s = 7 TeV, including the branching ratio H ZZ(*) and the subsequent decay Z ll (l = e,m). ...

Еще в разделе: (Показать все результаты (>205) - qfthep.sinp.msu.ru/ )

... Length = 4214630 Score = 44.1 bits (22), Expect = 1e-05 Identities = 22/22 (100%) Strand = Plus / Plus Query: 46 ggtcggtggttcgagtccactc 67 || Sbjct: 31975 ggtcggtggttcgagtccactc 31996 Score = 44.1 bits (22), Expect = 1e-05 Identities = 22/22 (100%) Strand = Plus / Plus Query: 46 ggtcggtggttcgagtccactc 67 || Sbjct: 11507 ggtcggtggttcgagtccactc 11528 Score = 40.1 bits (20), Expect = 2e-04 Identities = 20/20 (100%) Strand = Plus / Minus Query: 8 tagctcagttggttagagca 27 || ...

Еще в разделе: (Показать все результаты (>3781) - kodomo.cmm.msu.ru/ )

• http://kodomo.cmm.msu.ru/~christablel/term3/blastn.1fasta
• http://kodomo.cmm.msu.ru/~pavel_s/term3/blastn.txt
• http://kodomo.cmm.msu.ru/~vanilin/3_1/tRNA_blastn.txt

... Nonlinearity of Sound Wave Propagation and Stimulated Brillouin Scattering Process . A.I.Erokhin (Nonlinear Optics and Light Scattering Laboratory, Lebedev Physical Institute, Moscow, Russia) . ... Hypersound intensity in SBS process usually exceeds some kW/cm2 and is naturally expected to reveal nonlinear features. ... It causes the atypical acoustic nonlinearity appearance. ... New experimental approaches for investigation of intense hypersound propagation in liquids have been tried. ...

Еще в разделе: (Показать все результаты (>693) - acs366.phys.msu.su/ )

... в конференц-зале ГАИШ в 14 00 . ... Секретарь семинара М.К. Абубекеров . ... Липунов В.М. (ГАИШ МГУ) . ... Бескин В.С. (ФИАН РАН) . сопредседатель . ... Митрофанов И.Г. (ИКИ РАН) . ... Постнов К.А. (ГАИШ МГУ) . ... Курт В.Г. (АКЦ ФИАН) . ... Прохоров М.Е. (ГАИШ МГУ) . ... Имеется огромная потребность в обмене идеями и информацией сильно разделившихся в последние годы астрономических центров - ГАИШ, ФИАН (теор отдел), ИТЭФ, АКЦ ФИАН, Институт Астрономии, ИКИ, ИПМ, Институт Физпроблем, ИЯИ .. ...

Еще в разделе: (Показать все результаты (>588) - xray.sai.msu.ru/ )

• Population Synthesis of X-ray Sources at the Galactic Center
• Sergei Popov
• Black Holes in Binaries

... Новости . ... Музей . антропологии . ... Вестник МГУ Антропология . ... 26 ноября Музее антропологии открылась этнографическая выставка . ... Антропология" . ... Посмотреть фотографии . ... 2008-2010 Научно-исследовательский институт и Музей антропологии им.Д.Н.Анучина . Копирование материалов web-сайта только с разрешения администрации НИИ и Музея антропологии МГУ! ... При использовании материалов, размещенных на сайте НИИ и Музея антропологии МГУ, ссылка на источник обязательна! ...

Еще в разделе: (Показать все результаты (>30) - www.anthropos.msu.ru/ )

Lomonosov Moscow State University was established in 1755 . ... Lomonosov Moscow State University Diary . ... MSU Online . ... More than 40 000 students (graduate and postgraduate) and about 7 000 undergraduates study at the university, and over 5 000 specialists do the refresher course here. ... Moscow University campus is an extremely complex system, with its 1 000 000 m2 floor area in 1 000 buildings and structures, with its 8 dormitories housing over 12 000 students and 300 km of utility lines. ...

Еще в разделе: (Показать все результаты (>199) - www.msu.ru/ )

• The scheme of an arrangement of MSU buildings on Leninskiye Gory
• Exchanges with Moscow University

... 10 years ago the combination of two technologies ? genomic that allows to sequence genes of biosystems and mass-spectrometry analysis - converted the protein biochemistry into the Proteomics. ... Due to PCR there is no detection limit in genomics. ... Molecular counting technology in combination with the technology that allows to fish up and concentrate protein molecules on the surface consisting of high specific immobilized antybodies, aptamers and other ligates are used. ...

Еще в разделе: (Показать все результаты (>99) - www.msm.biophys.msu.ru/ )

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>29) - mouse.genebee.msu.ru/ )

• ConClus
• Nhunt: program for nucleic acid sequence similarity search
• Comparison of protein phylogeny reconstruction methods

Analysis of the ANTARES data for SN neutrino detection V. Kulikovskiy (MSU / INFN Genova) Hit counts in the detector. The number of hits ( hit counts ) in a time slice (104.8 ms) is used (this information is stored in each run) Mean number of hit counts in one PMT is ~5500 (corresponds to ~55 kHz) Expected number of hits from SN in 100ms is 11.6 ( 550 0) Bioluminescence bursts should be excluded Bioluminescence cut We have collected distributions of hit counts for each ...

Еще в разделе: (Показать все результаты (>27) - antares.sinp.msu.ru/ )

• http://antares.sinp.msu.ru/docs/Gracheva_Bamberg_22.09.11.pdf

The Fulbright Program in Russia . ... The Bureau of Educational and Cultural Affairs (ECA) of the United States Department of State is pleased to announce a new International Fulbright Science and Technology Award for outstanding foreign students. The award is designed to be among the most prestigious international scholarships in science and technology. The International Fulbright Science and Technology award is for PhD study at top U.S. institutions in science, technology, or engineering. ...

Еще в разделе: (Показать все результаты (>165) - www.prof.msu.ru/ )

• Differences in Russian and U.S. Academic Cultures
• Culture of Peace: Prospects for the 21-st Century
• Fulbright New Century Scholars Program, 2006

Выберите категорию обращения: Общие вопросы Отчеты Рейтинги Диссертационные советы Конкурсы Ввод данных Структура организаций Пользователи Проблемы с регистрацией\входом в систему . ... Войти в систему . ... Troitsky S.V. , Troitsky V.E. в журнале Physical Review D - Particles, Fields, Gravitation and Cosmology , издательство American Physical Society (United States) , том 91, ? ... Frere J.M. , Libanov M.V. , Nugaev E.Y. , Troitsky Sergey V. в журнале JHEP , том 306, с. 009 . ...

Еще в разделе: (Показать все результаты (>4592) - istina.msu.ru/ )

• Voloshin Yan Z. - сотрудник | ИСТИНА - Интеллектуальная Система Тематического
• VASIN V.A. - сотрудник | ИСТИНА - Интеллектуальная Система Тематического
• Topilina N.I. - сотрудник | ИСТИНА - Интеллектуальная Система Тематического

... The command to be executed can be given to pppd with the connect command line option. pppd will redirect the command's standard input and output to the serial line. ... Basically, a chat script consists of an alternating sequence of strings that we expect to receive from the remote system, and the answers we are to send. ... This is a typical excerpt from a chat script; ogin: b1ff ssword: s3kr3t This tells chat to wait for the remote system to send the login prompt, and return the login name b1ff. ...

Еще в разделе: (Показать все результаты (>202) - itpm.msu.su/ )

• The Login Chat
• ITPM MSU Web Page
• Installing the NNTP server

... During the rainy season, we checked each nest box each month in the daytime. ... We expected that nest boxes would be used as a shelter from the rain by small arboreal mammals, such as rats and flying squirrels in the rainy season more than in the dry season. ... From the late rainy season to the dry season, arboreal small mammals mainly used nest boxes: rats from August to February and flying squirrel in December. ... Communal nesting of southern flying squirrels in Florida // Journal of Mammalogy....

Еще в разделе: (Показать все результаты (>1379) - zmmu.msu.ru/ )

... On the Institute . ... Laboratory-chair of modelling the natural references of time . ... A.P. Levich , "Motivations and problems in the studies of time". in: "Constructions of Time in Natural Science: On the Way to Understanding the Time Phenomenon''. ... A.P. Levich , "Time as variability of natural systems: methods of quantitative description of changes and creation of changes by substantial flows. in: "Constructions of Time in Natural Science: On the Way to Understanding the Time Phenomenon". ...

Еще в разделе: (Показать все результаты (>492) - chronos.msu.ru/ )

• Laboratory-chair of Discrete mechanics on a microscopic scale
• Laboratory-Division Quantum Electrodynamics of Self-Organizing Systems and
• Russian Interdisciplinary Temporology Seminar

. To be sent no later than July 15 1999 . Surname First names : . Organisation/Institution: . Mailing address: . Email : . Telephone : . Fax (Full International) : . I expect to attend the Conference: . sure probably . I expect to be accompanied by . I expect to present a paper . Title of paper . Topic of the Conference . I expect to present a poster . Title of poster . Topic of the Conference .

Еще в разделе: (Показать все результаты (>176) - www.fadr.msu.ru/ )

• INQUA - SEQS
• Created with DiDa
• meetings