Formation of collimated ion beams with sub-relativistic femtosecond laser pulse using 2D microstructured foils Abstract. High-temperature plasma formed as a result of interaction of high power femtosecond laser impulse with matter. ... As a result, oxygen and iron ions were was shown and magnetic induction was estimated as = 0,54 ± Another result of this work was confirmation of the fact, that maximum ionic energy weekly depends on impulse duration in the interval 40 В 1500 . ...

Еще в разделе: (Показать все результаты (>171) - ofvp.phys.msu.ru/ )

• http://ofvp.phys.msu.ru/en/science_education/diploma/annot/2006/Kostryukov_Tunkin_en.pdf
• http://ofvp.phys.msu.ru/en/science_education/diploma/annot/2015/Tsymbalov_Savel'ev_en.pdf
• http://ofvp.phys.msu.ru/en/science_education/diploma/annot/2007/Zjabko_Parashuk_en.pdf

... In Banach spaces it is considered nonlinear equation with complex bifurcational parameter and densely defined closed linear Fredholm operators, the nonlinear term is sufficiently smooth. Beginning with the first works (V.I.Yudovich (1967), B.V. Loginov and V.A. Trenogin (1971)) on the usage of group symmetry conditions for nonlinear equation the question about simultaneous reduction of branching equation (BEq) on unknowns and equations (truncation reduction) has remained open. ...

Еще в разделе: (Показать все результаты (>426) - acs366.phys.msu.su/ )

• Abstract (Invited)

... MAXLEN parameter specifies maximum length of the number considered as a 'good' integer. ... If REJECTLONG = FALSE (default), than dictionary returns prefixed part of integer number with length MAXLEN . ... This is a dict_tmpl.c file. # include postgres.h # include utils/builtins.h # include fmgr.h #ifdef PG_MODULE_MAGIC PG_MODULE_MAGIC; #endif # include utils/ts_locale.h # include utils/ts_public.h # include utils/ts_utils.h typedef struct { int maxlen ; bool rejectlong ; } ...

Еще в разделе: (Показать все результаты (>2450) - www.sai.msu.su/ )

• SAL- Other Scientific Fields - Misc - Strata
• SAL- Programming - Tools & Utilities - CLUSTOR
• SAL- Mathematics - Misc - Fnord

Series on Stability, Vibration and Control of Systems, Series A - Vol. ... MULTIPARAMETER STABILITY THEORY WITH MECHANICAL APPLICATIONS . ... Review in Theoretical and Applied Mechanics . ... The main approach in studying stability of linear systems when the parameters of the system are changed is based on the authors own research. ... In Chapter 9 the multi-parameter stability theory of periodic systems is analyzed. ... Reviewed by Professor Teodor M Atanackovic . ...

Еще в разделе: (Показать все результаты (>31) - mailybaev.imec.msu.ru/ )

• Multiparameter Stability Theory with Mechanical Applications
• Book review by Professor Wolfhard Kliem

... The RADEN data bank produced at the Department of Chemistry of Moscow State University is designed as well to accumulate published information on radiative parameters of diatomic molecules, as to analyse it and recommend the more reliable values. ... electronic transition moments D ( R ); . ... dipole moments, . ... FACTUAL RECOMMENDED DATABASE contains now the ab initio and experimental electronic transition moments for more than 250 band systems which belong to more than 100 diatomic molecules. ...

Еще в разделе: (Показать все результаты (>79) - electr003.chem.msu.ru/ )

... Results . ... Functional scheme of information flows under model studies of biosystems structure. ... Members of the group together with other Institutes of the RAS and departments of different Ministries (Education and Sciences, Natural resources and Agricultural) have created the pilot versions of the basic WEB-oriented information systems, which are actively used by many users in the global net of Internet. ...

Еще в разделе: (Показать все результаты (>4555) - www.sevin.ru/ )

• Laboratories: Laboratory for Comparative Ethology and Biocommunication: Results
• Laboratories: Laboratory of Analytical Ecotoxicology: Results
• Laboratories: The security center of Biosystems: Results

The QKeyEvent class contains parameters that describe a key event. ... QKeyEvent  ( int type, int key, int ascii, int state )  . ... void  accept  ()  . ... Key events occur when a key is pressed or released when a widget has keyboard input focus. A key event contains a special accept flag which tells whether the receiver wants the key. ... Constructs a key event object. ... Sets the accept flag of the key event object. ... Clears the accept flag parameter of the key event object. ...

Еще в разделе: (Показать все результаты (>463) - rtm-cs.sinp.msu.ru/ )

• Arrays
• Unions
• A C++ Client

... Data . ... Models . Solar energetic particles . Paraboloid model . ... Neutron flux variations (RU) . ... This program package is intended to prognose the environment on the board of near-earth elliptic orbiting satellites in the open space as well as behind the Al shielding. ... Next is the required spectrum type (integral or differential). ... sp_x.txt - solar proton spectrum behind shielding, fluence . sn_x.txt - solar neutron spectrum behind shielding, fluence . ... Solar . ...

Еще в разделе: (Показать все результаты (>32) - smdc.sinp.msu.ru/ )

• APEV service - Space monitoring data center

... About 70 scientific papers. The theory of square parachute is created, describing distribution of parameters of shape, tension and resistance to airflow of canopy in steady-state condition for various sets of suspension line lengths and air-permeability. ... The practical recommendations for optimal parachute application are submitted. ... It is discovered experimentally that a character of pressure distribution for a square canopy depends on a particular choice of suspension line lengths. ...

Еще в разделе: (Показать все результаты (>10) - margaret.imec.msu.ru/ )

• Large-Scale Load Stabilization
• Air-Permeability Influence on Pressure Distribution Character
• On Square Parachute Differential Equations

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>10) - mouse.genebee.msu.ru/ )

• Nhunt: program for nucleic acid sequence similarity search

... Vestnik Moskovskogo Universiteta. Seriya 1. Matematika. Mekhanika. ...

Еще в разделе: (Показать все результаты (>328) - vestnik.math.msu.su/ )

• Vestnik Moskovskogo Universiteta. Seriya 1. Matematika. Mekhanika

Estimation of translational importance of mammalian mRNA nucleotide sequence characteristics based on ribosomal profiling data O.A. Volkova1,*, Y.V. Kondrakhin2,3, R.N. Sharipov 1 2,3,4 Institute of Cytology and Genetics, SB RAS, Novosibirsk, Russia 2 Design ... Novosibirsk, Russia 4 Novosibirsk State University, Novosibirsk, Russia *ov@bionet.nsc.ru Keywords: ribosome profiling, RiboSeq, 5'UTR , mRNA , ... Until recent time there were no experimental data on the translation efficiency. ...

Еще в разделе: (Показать все результаты (>237) - mccmb.belozersky.msu.ru/ )

• http://mccmb.belozersky.msu.ru/2013/abstracts/abstracts/26.pdf
• http://mccmb.belozersky.msu.ru/2015/proceedings/abstracts/16.pdf
• http://mccmb.belozersky.msu.ru/2013/abstracts/abstracts/246.pdf

A GENETIC ALGORHYTM FOR OPTIMIZING A NEURAL NETWORK CAPABLE TO LEARN FOR FOOD SEARCHING IN A RADIAL MAZE Budilova E.V., Chepurnova N.E., Chepurnov S.A, Teriokhin A.T. M.V.Lomonosov Moscow State University, Dept. of Biology. ... The upper platform has a hole in the middle and several radially directed tubular canals ("arms") each of which can contain a peace of food and has doors opening only in the centrifugal direction. ... The task of the animal is to visit only those arms which contain food. ...

Еще в разделе: (Показать все результаты (>29) - ecology.genebee.msu.ru/ )

• http://ecology.genebee.msu.ru/3_SOTR/CV_Terekhin_publ/2000_Longev_JEvolBio.pdf

... Wt::WValidator::Valid) { + new Wt::WBreak(results_panel); + new Wt::WText("Enter delta parameter", results_panel); return; } if (min_block_width_input->validate() != Wt::WValidator::Valid) { + new Wt::WBreak(results_panel); + new Wt::WText("Enter min block width parameter", results_panel); return; } if (timeout_input->validate() != Wt::WValidator::Valid) { + new Wt::WBreak(results_panel); + new Wt::WText("Enter timeout parameter", results_panel); return; } if (timeout2_input->validate() != ...

Еще в разделе: (Показать все результаты (>10914) - kodomo.fbb.msu.ru/ )

• allpy: 1785e40b2a2d sandbox/ttk.py
• allpy: 8a81996f8bda sandbox/ttk.py
• allpy: 6724650b2175

... The purpose of our research was to find significant differences in island and mainland plant populations of the Russian White Sea. ... New islands were inhabited from the mainland, and as a result the population on it becomes isolated from the mainland. ... As a result the island population becomes different from the mainland populations. ... On each plant we measured about 8–12 morphological characteristics, which are known to be the most variable; 59 morphological characteristics in all. ...

Еще в разделе: (Показать все результаты (>188) - herba.msu.ru/ )

Recent results from CMD-3 detector Peter A. Lukin (on behalf of CMD-3 Collaboration) Outline 26/08/ 2013 Introduction Collider Detector Preliminary Results Conclusion XVI Lomonosov Conference on Elementary Particle Physics , Moscow , MSU 1 Measurement of the cross section e+e- hadrons in the low energy range is interesting for: measurement of parameters of light vector ... 26/08/2013 XVI Lomonosov Conference on Elementary Particle Physics, Moscow, MSU 12 Study of e e 0 0 w(782) r . ...

Еще в разделе: (Показать все результаты (>240) - nuclphys.sinp.msu.ru/ )

• The European X- Ray Free-Electron Laser

... О UNИX . ... MonthCalendar . ... Show Single Month . Entire Year Calendar . Markup . Result . Current Month Calendar . ... MonthCalendar(BasePage,year,month,monthoffset,monthoffset2,height6,anniversary,template)>> . ... Base page for calendar entry pages. year . ... Year to display on calendar. month . ... Year calendar (no year in page links). template . ... 2016 / 4 > >> . ... Calendar of year 2002 (every month padded to height of 6): . ... Year 2002 . ... see also: HelpOnMacros . ...

Еще в разделе: (Показать все результаты (>339) - uneex.lorien.cs.msu.su/ )

• mod_negotiation - Apache HTTP Server
• LecturesCMC/LinuxNetwork2013/Results - UNИX
• LecturesVMSH/Python/2013-10-11/Results - UNИX

... О UNИX . ... MonthCalendar . ... Show Single Month . Entire Year Calendar . Markup . Result . Current Month Calendar . ... MonthCalendar(BasePage,year,month,monthoffset,monthoffset2,height6,anniversary,template)>> . ... Base page for calendar entry pages. year . ... Year to display on calendar. month . ... Year calendar (no year in page links). template . ... 2016 / 4 > >> . ... Calendar of year 2002 (every month padded to height of 6): . ... Year 2002 . ... see also: HelpOnMacros . ...

Еще в разделе: (Показать все результаты (>111) - uneex.mithril.cs.msu.su/ )

• LecturesVMSH/Python/2013-10-11/Results - UNИX
• LecturesCMC/LinuxNetwork2013/Results - UNИX
• HelpOnMoinCommand/ExportDump - UNИX

... In this study we try to answer the question about the possible primary melt for Guli massif, comparing the composition of spinel-group minerals from the dunites of Guli massif with model compositions of spinel-group minerals, which are in equilibrium in system, chemically corresponding with primary melt. We consider three candidates to be a primary melt for Guli massif: meimechite, picrite and khatangite. ... The influence of this factor is strongly limited by the H 2 O solubility in the melt. ...

Еще в разделе: (Показать все результаты (>475) - geo.web.ru/ )

• Harvard Seismology: 3-D Earth Structure

... Next: Index Up: Scanning Probe Microscopy Image Previous: COM-port initialization file format Contents Index . Figure D.1: Parameters of 3D Images . ... Intensity of material emission (Mat. ... material color for diffused light (Mat. ... material reflection color for directed light (Mat. ... material reflection color for reflected light (Mat. ... intensity of directed light (Light Diffuse) . ... Material Shininess) In our case we use the model, where , and this parameter is called Material Color. ...

Еще в разделе: (Показать все результаты (>107) - www.spm.genebee.msu.ru/ )

• Scan parameters
• Plane tab
• Microscope Parameters Data