... Hamiltonian Systems and the Generation of Vortex Structures in Fluid Motion . ... It followes in this case that there exists the coordinate system such that the evolution of two of the coordinates is governed by a time-dependent Hamyltonian system with the evolution of remaining coordinate being governed by a first order differential equation that depends only on the other two coordinates and time. ... The process of arising, evolution and disappearance of the vortex structures is described. ...

Еще в разделе: (Показать все результаты (>380) - acs366.phys.msu.su/ )

• Abstract (Invited)

... 20.09.2009 . ... Moscow Vyatichi, November 9 - 11, 2009. ... Opt., 2009, v. 11, 074008 . ... In this work we study sum-frequency generation from the surface of an isotropic chiral medium in arbitrary interaction geometry of the paraxial light beams at fundamental frequencies. ... Within the first-order approximation approach, generally, the polarization state of light is distributed inhomogeneously in the reflected signal beam cross section, and the transversal intensity distribution is not Gaussian...

Еще в разделе: (Показать все результаты (>139) - ilc.phys.msu.ru/ )

• Публикация

... FPGA design, architecture, means and methods of work. ... FPGA stands for Field-Programmable Gate Array, which is a semi-conductive crystal, the connections between gates of which and the logic of work can be modeled and changed repeatedly during its work. ... Each semester has 12 obligatory classes of four (4) academic hours each once a week, which totals in 48 hours per semester. ... In spring semester students have 44 hours to work on their term papers on design and then 4 hours for defending...

Еще в разделе: (Показать все результаты (>23) - engineering.phys.msu.ru/ )

• Parallel Programming
• Microcontroller Programming
• Introduction to Linux

HTML is an application conforming to International Standard ISO 8879 -- Standard Generalized Markup Language (SGML). ... Every SGML document has three parts: . SGML declaration . ... For example, the SGML declaration in the HTML DTD specifies that the string that opens an end tag is </ and the maximum length of a name is 72 characters. ... Most HTML elements are identified in a document as a start tag, which gives the element name and attributes, followed by the content, followed by the end tag. ...

Еще в разделе: (Показать все результаты (>164) - comet.sai.msu.ru/ )

• Collection of Net References - Frame version
• References
• The Head Element and Related Elements

... file . ... 1 """ Functions to get pdb information from fasta id . ... 4 pdb information: code, chain, model . ... 6 TODO: same for local pdb files . ... 19 def std_id ( pdb_id , pdb_chain , pdb_model = None ): . 20 if pdb_model : . 21 return " %s _ %s _ %s " % \ . ... strip (), pdb_chain . ... strip (), pdb_model ) . ... 27 def pdb_id_parse ( ID ): . ... 30 return None . ... 44 #~ Parse standart ID to pdb_code, chain and model . ... 58 #~ model = None . ... 66 #~ return code, chain, model . ...

Еще в разделе: (Показать все результаты (>20219) - kodomo.fbb.msu.ru/ )

• allpy: allpy/pdb.py annotate
• allpy: log
• allpy: allpy/base.py history

azarovav@hotbox.ru ; tvc-t@bk.ru HU UH HU U The modern method for testing of the precision optical details surface structure with using of white light interferometry is considered. Measurement results of laser gyroscopic mirrors profiles, received with help of the surface structures analyzer New View 6200, are discussed. ... New View 6200 (NV). ... New View 6200 NV .1. - - , : 550 nm, 125 nm 2,4 µm. , , , . ... 37, 4, .399-404, 2007. ... 1976. ... White light interferometric surface profiler. ...

Еще в разделе: (Показать все результаты (>236) - nuclphys.sinp.msu.ru/ )

• The European X- Ray Free-Electron Laser
• Журналы включенные в NSR (Nuclear Science References)

npidb:// home / introduction . Russian version of this document . The database NPIDB (Nucleic acid ? Protein Interaction DataBase) contains information derived from structures of DNA-protein and RNA-protein complexes extracted from Protein Data Bank (PDB) (1932 complexes in the end of 2007). ... Provide an essential information on structural features of DNA-protein and RNA-protein interaction for the users who need to get acquainted with the problem. ... NPIDB . ...

Еще в разделе: (Показать все результаты (>5522) - monkey.belozersky.msu.ru/ )

• HF clusters: algorithm

Geometric Structures in Integrable Systems Sergey Adzhiev (with Victor Vedenyapin), Entropy for generalised quantum kinetic and Liouville equations. Abstract: In his 1872 paper L. Boltzmann proved H-theorem for a class of kinetic equations. ... Abstract: P. Clarkson and M. Kruskal (1989) proposed a method for finding reductions of partial differential equations with two independent variables. ... Gennady El, Kinetic equation for a soliton gas ­ a new integrable system? ...

Еще в разделе: (Показать все результаты (>95) - new.math.msu.su/ )

• http://new.math.msu.su/department/probab/bsk_18_6.html

Справочники по истории на русском языке в Интернете . ... Хотя мы считаем, что на нижеперечисленных сайтах собрана полезная информация, . ... Хронологические таблицы по истории Азии I-XVIII вв. на Центральноазиатском историческом сервере . ... статьи из Брокгауза и Ефрона . ... Малый энциклопедический словарь Брокгауза и Ефрона также на разных сайтах: . ... Информация о руководителях различных государств, ныне существующих и существовавших в истории. ... Справочник по истории Третьего Рейха . ...

Еще в разделе: (Показать все результаты (>236) - hist.msu.ru/ )

• History of Russia. Electronic resources
• Labour recruiting policy and the Nobel Association of Oil Producers. A Set of

... ICONO Invited Speakers . ... Gennadiy Kulipanov, Budker Inst. of Nuclear Physics, Russia . ... Marlan Scully, Texas A&M Univ., ... Andrey Goncharov, Inst. of Laser Physics, Russia . ... Vladimir Trunov, Inst. of Laser Physics, Russia . ... Since 1987, he has worked at the National Research Council of Canada (Ottawa) in the field of laser physics and trapped ion optical frequency standards. ... Alexey Taichenachev , Inst. of Laser Physics, Russia . ... S. Vatnik, Inst. of Laser Physics, Russia . ...

Еще в разделе: (Показать все результаты (>8) - iconolat13.phys.msu.ru/ )

• Program topics
• Symposia

... Development of a candidate secondary reference procedure (immunoassay based measurement procedure of higher metrological order) for cardiac troponin I: I. Antibody characterization and preliminary validation. ... In this study, the first steps in the development of a secondary reference measurement procedure (RMP) 'higher metrological order measurement procedure' to support the cardiac troponin I (cTnI) standardization initiative is described. ...

Еще в разделе: (Показать все результаты (>98) - biochem.bio.msu.ru/ )

• Generation of recombinant antibodies and means for increasing their affinity.
• Structure and properties of G84R and L99M mutants of human small heat shock
• Three-dimensional structure of alpha-crystallin domain dimers of human small

... Class . ... METHOD . ... ucar.netcdf.NetcdfRemoteProxyImpl . All Implemented Interfaces: . ... public class NetcdfRemoteProxyImpl . ... This class provides implementation of the interface NetcdfRemoteProxy. ... Constructor Detail public NetcdfRemoteProxyImpl ( NetcdfServer svr, java.lang.String key, AbstractNetcdf nc) throws java.rmi.RemoteException . ... a (Remote)Accessor for the Variable. public void release () throws java.rmi.RemoteException . ... release in interface NetcdfRemoteProxy . ...

Еще в разделе: (Показать все результаты (>70) - angel.cs.msu.su/ )

• PhD Summer School on Scentific Computing
• : Class RemoteNetcdf
• : Package ucar.multiarray

Shipunov A.B. Systema Naturae [Electronic resource]. 1995 onwards. ... Pyramid of kingdoms , in SVG . ... Systema Naturae or the outline of living world classification // Protistology. ... The classification has: (1) small number of kingdoms; (2) large phyla; (3) incorporating as much as possible taxonomical data from different sources. ... The classification utilizes all described groups of living organisms, excluding fossils and viruses, from kingdoms and down to the level of class. ...

Еще в разделе: (Показать все результаты (>6191) - herba.msu.ru/ )

• Systema Angiospermarum
• Georg Franz Hoffmann
• BIOL 310: Ethnobotany

Firefly (previously known as the PC GAMESS) is a freely available ab initio and DFT computational chemistry program developed to offer high performance on Intel-compatible x86, AMD64, and EM64T processors. ... At moment, Firefly includes no more than 5% of the legacy code. ... Firefly is freely available for all main PC operating systems: Windows, Linux, and Mac OS X. Firefly supports various Windows versions including Windows 8, Windows 7, Windows Server 2008, Vista, 2003, XP, 2000, NT, and 98/Me. ...

Еще в разделе: (Показать все результаты (>65) - classic.chem.msu.su/ )

• PC GAMESS/Firefly DOCUMENTATION - CI SINGLES
• PC GAMESS/Firefly DOCUMENTATION - TDDFT
• PC GAMESS/Firefly DOCUMENTATION - FAST MATRIX DIAGONALIZATION AND INVERSION

This module provides for server-side imagemap processing. ... Configurable generation of imagemap menus. The lines in the imagemap files can have one of several formats: directive value [x,y ...] . ... The directives can come in any order, but are processed in the order they are found in the imagemap file. base Directive . ... Module: mod_imap . ... Its value is overridden by a default directive within the imagemap file. ... Its value is overridden by a base directive within the imagemap file. ...

Еще в разделе: (Показать все результаты (>79) - neptun.sai.msu.ru/ )

• Apache module mod_expires
• Apache API notes
• Apache module mod_log_referer

... The RADEN data bank produced at the Department of Chemistry of Moscow State University is designed as well to accumulate published information on radiative parameters of diatomic molecules, as to analyse it and recommend the more reliable values. ... electronic transition moments D ( R ); . ... dipole moments, . ... FACTUAL RECOMMENDED DATABASE contains now the ab initio and experimental electronic transition moments for more than 250 band systems which belong to more than 100 diatomic molecules. ...

Еще в разделе: (Показать все результаты (>98) - electr003.chem.msu.ru/ )

• Laboratory of Electrical Double Layer and Electrode Kinetics
• Pages of history
• Veronika K. Laurinavichute: Selected Publications

... Supercomputing Technologies in Science, Education and Industry Almanac Series . ... DiMMon: a New Approach to Supercomputer Monitoring . ... Kazan National Research Technological University . ... AREA: Physical Chemistry, Optics and Quantum Electronics . ... Moscow State Uiversity . DRIVER: Supercomputer-aided development of new mid-infrared laser technologies. ... AREA: Optics and Quantum Electronics . ... Research Computing Center (RCC) of Lomonosov Moscow State University . ...

Еще в разделе: (Показать все результаты (>52) - hpc.msu.ru/ )

• APPLICATIONS: Fundamental Medicine and Phisiology | Moscow University
• APPLICATIONS: Electronics and Acoustics | Moscow University Supercomputing
• APPLICATIONS: Radiophysics | Moscow University Supercomputing Center

... wLake 1.7 . wLake is a tool which allows to identify clusters of a structural water molecules in given superimposed 3D structures. Put your coordinates in PDB format into the text area. Select a distance threshold. Two water molecules from different structures will be concidered as located in the same space point if the distance between centers of oxygen atoms is less than this threshold. ... EACH STRUCTURE INCLUDING ITS WATER MOLECULES MUST BE PRESENTED AS SEPARATE MODEL: EXAMPLE. ...

Еще в разделе: (Показать все результаты (>16) - mouse.belozersky.msu.ru/ )

• Geometrical core
• S : 3D_of_rm_system_components

... MG1655 chromosome, complete genome Length=300 Score E Sequences producing significant alignments: (Bits) Value embl|AE009441|AE009441 Pyrobaculum aerophilum str. ... Length=2222430 Score = 98.4 bits (402), Expect = 5e-21 Identities = 150/234 (65%), Gaps = 1/234 (0%) Strand=Plus/Plus Query 68 CCCGCAGAAGAAGCACCGGCTAACTCCG-TGCCAGCAGCCGCGGTAATACGGAGGGTGCA 126 || ... Sbjct 97796 GTTCTCCCGCCGAAGTGCTTGAGATACTCGCAACCGTGAATCTCAAAAAGAGG 97848 > embl|AE006641|AE006641 Sulfolobus solfataricus P2, complete...

Еще в разделе: (Показать все результаты (>22) - mouse.genebee.msu.ru/ )

• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/blast_default.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/megablast.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex3/megablast.out

... Home . ... Board of directors . About the project . ... Read more . ... Project director . ... PhD, Research Associate . Director of the scientific part of the project . ... PhD, Deputy Vice-Rector . Technical Coordinator . ... Project coordinator . ... Coordinator of "Biological information" part of the project . ... Coordinator of "Human biomaterial" part of the project . ... Coordinator of "Animals" part of the project . ... Coordinator of "Plants" part of the project . ...

Еще в разделе: (Показать все результаты (>6) - depository.msu.ru/ )