MOSCOW STATE UNIVERSITY -- Faculty of Biology -- Department of Human Physiology -- . ... Our interest is the secret springs of work of a brain. How can a new idea be born in the brain if the physical environment remains constant? ... What mechanisms of the brain are broken in schizophrenia? ... For this purpose we create brain-computer interfaces (BCI) based on modern methods of computational electroencephalography. ... Department of Human Physiology . ... Former Visitors . ... Former students . ...

Еще в разделе: (Показать все результаты (>72) - brain.bio.msu.ru/ )

• Sergei Shishkin * Сергей Шишкин
• Links -- Laboratory for Neurophysiology and Neuro-Computer Interfaces (MSU,
• Patents -- Laboratory for Neurophysiology and Neuro-Computer Interfaces

... Кафедра математического моделирования и информатики . ... Добро пожаловать на сайт кафедры математического моделирования и информатики , заведующий кафедрой ? ... студент младших курсов и хотите делать у нас курсовую или поступать к нам, ознакомьтесь с основными направлениями деятельности кафедры и предлагаемыми темами курсовых работ. Может быть, вам нужны материалы по программированию , теории вероятностей , специальным курсам или математическим дисциплинам по выбору . ... Программирование . ...

Еще в разделе: (Показать все результаты (>6) - cmp.phys.msu.ru/ )

• Welcome! | Chair of Computer Methods of Physics
• User account | Chair of Computer Methods of Physics
• Contacts | Chair of Computer Methods of Physics

International Laser Center of MSU . ... Scientific Laboratories . Science . ... 15:00 S.A. Akhmanov Hall, Nonlinear Optics Bld. ... Home Science and education Scientific Laboratories Laboratory of computer simulations in optics . ... Dergachev Aleksandr Aleksandrovich Ph.D. Dormidonov Aleksandr Evgen'evich Ph.D. Kandidov Valeriy Petrovich Doctor of science . ... Femtosecond Nonlinear Optics of High Power Laser Radiation . Femtosecond TW Laser Pulse Filamentation in Gases and Condensed Media . ...

Еще в разделе: (Показать все результаты (>96) - ilc.phys.msu.ru/ )

• "Computers and measurements" practical course laboratory

... Research . ... Kazakevich , Olga Anatolievna – director of the Laboratory, Candidate of Science, Philology . Bagaryatskaya , Tatiana Borisovna – computer programmer . Budyanskaya , Elena Mikhailovna – leading computer programmer . ... Galiamina, Julia Yevghenievna – junior research assistant, Candidate of Science, Philology . Zayonchkovskaya , Valeriya Petrovna – computer programmer, 2 category . ... Rafaeva , Anna Valerjevna – research assistant , Candidate of Science, Philology . ...

Еще в разделе: (Показать все результаты (>63) - lcl.srcc.msu.ru/ )

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>11) - mouse.genebee.msu.ru/ )

• Nhunt: program for nucleic acid sequence similarity search

... A sample invocation for the Ethernet interface eth0 may look like this: # ifconfig eth0 eth0 Link encap 10Mbps Ethernet HWaddr 00:00:C0:90:B3:42 inet addr 191.72.1.2 Bcast 191.72.1.255 Mask 255.255.255.0 UP BROADCAST RUNNING MTU 1500 Metric 0 RX packets 3136 errors 217 dropped 7 overrun 26 TX packets 1752 errors 25 dropped 0 overrun 0 The MTU and Metric fields show the current MTU and metric value for that interface. ... If a broadcast address has been set, ifconfig displays the BROADCAST flag.) . ...

Еще в разделе: (Показать все результаты (>275) - itpm.msu.su/ )

• Typically Used sendmail.m4 Parameters
• Logins via the network
• HTML Document Character Set

... THE PARALLELIZATION OF COMPUTATIONAL ALGORITHMS IN LARGE PHYSICS PROBLEMS ON MULTIPROCESSOR COMPUTER SYSTEM CONTAINING THOUSAND AND MORE OF PROCESSOR ELEMENTS REQUIRES SPECIAL TOOLS. ... THE GENETIC ALGORITHM CAN BE CHARACTERIZED BY THE FOLLOWING PARAMETERS: - coding strategy, - population size, - initialisation strategy, - selection technique, - crossover mechanism, - mutation mechanism, - strategy for offspring inclusion. ... The results are presented on the following figure. ...

Еще в разделе: (Показать все результаты (>73) - acat02.sinp.msu.ru/ )

• http://acat02.sinp.msu.ru/presentations/morhac/ACAT2002_Morhac_ID142.pdf
• http://acat02.sinp.msu.ru/presentations/konash/Slides_ACAT2002.doc
• http://acat02.sinp.msu.ru/presentations/strandlie/talk.pdf

... MSU's HPC HISTORY . ... In 1956, Research Computing Center (RCC) of Moscow State University received its first computer тАЬStrelaтАЭ. ... BESM-6 computer was and still is considered to be of great importance to USSRтАЩs/RussiaтАЩs history of computer development. ... Same year RCC received its first BESM-6 computer, and despite its serial number 13 it proved to be lucky for the Center. ... Research Computing Center (RCC) of Lomonosov Moscow State University . ... Excursions to Supercomputing Center ...

Еще в разделе: (Показать все результаты (>70) - hpc.msu.ru/ )

• X-COM: DISTRIBUTED COMPUTING SOFTWARE | Moscow University Supercomputing Center
• MSU SUPERCOMPUTERS: "LOMONOSOV" | Moscow University Supercomputing Center
• JOINT MSU-INTEL CENTER ON HIGH PERFORMANCE COMPUTING | Moscow University

Welcome , Registration , and other StartingPoints ; TWiki history & Wiki style; All the docs.. ... Line: 1 to 1 . ... Changed: . ... It should correspond to the format of the format parameter. ... Topic:* | ... FAQ\:[\n\r]*([^\n\r]+).*) [[$topic][Answer.. ... SEARCH{ "\.*" scope="topic" regex="on" nosearch="on" nototal="on" order="modified" reverse="on" format="| [[$topic]] | ... SEARCH{ "\.*" scope="topic" type="regex" nosearch="on" nototal="on" order="modified" reverse="on" format="| [[$topic]] | ...

Еще в разделе: (Показать все результаты (>35930) - dualopt1.cmm.msu.ru/ )

• IncludeTopicsAndWebPages - TWiki - TWiki - (printable)
• VarURLPARAM - TWiki - TWiki
• VarURLPARAM - TWiki - TWiki - (printable)

... education . ... Composite materials . Materials for solar and fuel cells . ... Registration deadline is 30 April 2012. ... New deadline is 15 May 2012 . ... Registration fee should be paid before 10 June 2012. ... For information please contact Mrs. Olga Bogomolova: obogomol@gmail.com and Dr. Alexander Chertovich: chertov@polly.phys.msu.ru . ...

Еще в разделе: (Показать все результаты (>25) - nano.msu.ru/ )

• Registration for the International School ?Computer simulation of advanced

... Spectral and kinetic parameters of phosphorescence of triplet chlorophyll a in the photosynthetic apparatus of plants. ... Spectral and kinetic parameters and quantum yield of IR phosphorescence accompanying radiative deactivation of the chlorophyll a (Chl a) triplet state were compared in pigment solutions, greening and mature plant leaves, isolated chloroplasts, and thalluses of macrophytic marine algae. ... This parameter is stable in leaves of different plant species. ...

Еще в разделе: (Показать все результаты (>20) - biochem.bio.msu.ru/ )

... Магистерское образование . ... Студенты . ... Курсы повышения квалификации . ... Sat, 04/09/2016 - 04:46 ? zavuch . ... В четверг, 31 марта 2016 г. занятия О.Р. Лапониной по курсу "Технологии и принципы обеспечения безопасности в сети интернет" - отменяются. ... Студенты магистратуры 2-го курса, до 15 февраля обязательно пришлите на почту темы вашей магистерской диссертации, заполнив форму План по НИР для студентов магистратуры. ... Телефоны: 8 (499) 216-50-50, 8 (495) 989-50-50 . ...

Еще в разделе: (Показать все результаты (>27) - hcs.cmc.msu.ru/ )

• Master program "Mathematical and computer methods of image processing" |
• The core courses for the specialty "Applied Mathematics and Computer Science".
• Master program "Software for Computer Networks" | Магистерское и послевузовское

О лаборатории . ... Лаборатория теоретической биофизики . ... Here the guide to use RESP technique based on calculations from Firefly or GAMESS-US is presented. ... Note, that RESP algorythm will fit potential in the set of points which are selected according to $PDC group in the input-file. ... Нет комментариев " Using RESP with GAMESS-US and Firefly (PC-GAMESS) " . ... Using Firefly/GAMESS-US efficiently . ... Scannin? in Using Firefly/GAMESS-US efficiently? 2012 ERG Research Group . ...

Еще в разделе: (Показать все результаты (>16) - erg.biophys.msu.ru/ )

. This is a framed page, but your browser doesn't support frames. Get FireFox!

Еще в разделе: (Показать все результаты (>175) - lnfm1.sai.msu.ru/ )

• IMCCE-SAI: Natural Satellites Service. Parameters and constants
• The determination of parameters of the gravity anomalies sources
• Natural Satellites Data Center. Objectiv.

... useful to make html . HTML-standarts . Characters for html . ... Research computing center at MSU . ... Fortran . ACME-brand Unix software . Screen Savers (Lunar craters, Sky and others for Windows and for Unix) . Golden Software: Surfer, Grapher, MapViewer and Didger . ... Scientific Research Computational Center in MSU . Fortran Library Mark 18 . NAG library . ... ISM-computers . ... White Wind - computers . R-style computers . ...

Еще в разделе: (Показать все результаты (>12) - astrometric.sai.msu.ru/ )

• Specification

... Recommended values . Start word length . Start length of motiff for Multiple sequence alignment. ... Max N Mismatches . ... Min score . ... Gap parameter . This parameter defines gap scoring. the grater this value is the stronger gap will be panalysed . ... If inforation content of a column is less than given value the column should be not included into alignment. the grater this value is the stronger gap will be panalysed . ... Max loop . Max energy of a helix . ... cgcatagctc cacca . ...

Еще в разделе: (Показать все результаты (>6) - bioinf.fbb.msu.ru/ )

• input

. [ Войти ] . Главная -> Фильмы -> Computer Boy . Пользователи . Демо . Деньги . Фильмы . Форум . Computer Boy . Австралия 2000 . отметить . Комедия . Триллер .

Еще в разделе: (Показать все результаты (>78) - kinfo.ru/ )

• The Computer Wore Tennis Shoes - Фильмы - Kinfo.ru
• The Story of Computer Graphics - Фильмы - Kinfo.ru

Копировать из putty текст в буфер обмена и обратно . ... Например, если неправильно ввели в интерактивном режиме программы EMBOSS какой-нибудь параметр и не хотите продолжать - зарубите ее, нажав Ctrl-C. Вызывать аналог far (Midnight Commander) прямо в putty . ... less . Искать в less какое-нибудь слово . ... Чтобы выйти из less, надо нажать q. Напоминаю также, что когда вы говорите "man что-то" или "tfm что-то", то текст руководства у вас тоже показывается в less, так что слеш можно использовать. ...

Еще в разделе: (Показать все результаты (>6663) - kodomo.fbb.msu.ru/ )

• allpy: log
• allpy: 1785e40b2a2d .hgignore
• allpy: 1785e40b2a2d .hgtags

Кафедра высокопроизводительных вычислений МГУ . Главная . ... Главной задачей кафедры является организация и осуществление на высоком уровне учебно-воспитательной работы по подготовке специалистов высокой профессиональной квалификации по высокопроизводительным вычислениям на многопроцессорных ЭВМ из числа студентов 2-5 курсов механико-математического факультета , физического факультета , факультета вычислительной математики и кибернетики, химического факультета и других факультетов ...

40. http://ecology.genebee.msu.ru/3_SOTR/CV_Terekhin_publ/2001_RadialMaze.doc