... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>10) - mouse.genebee.msu.ru/ )

• Nhunt: program for nucleic acid sequence similarity search

... Publications . ... Laboratory of Mathematical Methods of Image Processing . Chair of Mathematical Physics . ... Fast Rank Algorithms Based on Multiscale Histograms and Lazy Calculations . ... Rank algorithms allow effective solutions for image smoothing and impulse noise suppression, but . ... achieved a processing speed for EV and KNV neighborhood average algorithms that is close to the fastest . ... Title = {Fast Rank Algorithms Based on Multiscale Histograms and Lazy Calculations}, . ...

Еще в разделе: (Показать все результаты (>313) - imaging.cmc.msu.ru/ )

• Fast rank algorithms | Laboratory of Mathematical Methods of Image Processing

... These spectral characteristics compare with introduction (ВВЕДЕНИЕ) At last time many workers have studied thermal Rayleigh-Benard convection using numerical At last time many workers have studied thermal Rayleigh- Benard convection using numerical time many At last time many workers have studied thermal Rayleigh-Benard convection using numerical used spectral methods with periodic boundary conditions. ... In numerical simulations were derived secondary stationary, [pic] where ? ...

Еще в разделе: (Показать все результаты (>13) - hit-conf.imec.msu.ru/ )

... Molecular Mechanics Calculations of beta-Diketonate, Aqua, And Aqua-beta-Diketonate Complexes of Lanthanide Ions Using Gillespie-Kepert Model . ... Abstract - A version of molecular mechanics based on the Gillespie-Kepert model of coordination bonds "repulsion" is applied to lanthanide complexes. ... For the aqua complexes, typical root-mean-square deviation (calculated vs. ...

Еще в разделе: (Показать все результаты (>25) - analyt.chem.msu.ru/ )

• Molecular mechanics study of the mixed-ligand lanthanide complexes using
• Study of amino- and pyridyl-containing zinc(II) and cadmium(II) complexes by

... 90-day forecast for X, Y, UT1-UTC. ... 6-year base period (~2190 points).For UT1-UTC and LOD tidal variations in the Earth rotation IERS Convention 2000 model excluded, then included and predictions are performed for differences. Trend of the second order modeled for all, except LOD. ... Autocorrelation function estimated from 6-year base period (~2190 points), last 200 are points used for prediction. For UT1-UTC and LOD predictions are performed for differences. ...

Еще в разделе: (Показать все результаты (>137) - lnfm1.sai.msu.ru/ )

• Natural Satellites Data Center. Objectiv.
• Data bases of Natural Satellites. Documentation. Structure

. Description . Annotation database for human . Annotation database for mouse . Annotation database for rat Partially suppurted by RFBR grant 10-07-00685-а . Ramil Nurtdinov

Еще в разделе: (Показать все результаты (>5457) - monkey.belozersky.msu.ru/ )

• About authors ot this complex
• Inquiry information || Parsimony algorithm
• About this project

... CompHEP Models. ... CompHEP is based on an idea of the physical model. ComHEP Models are very simular to physical models in high energy physics, like Standards Model or MSSM. ... Two of them are versions of the Standard Model (SU(3)xSU(2)xU(1)) in the unitary and t'Hooft - Feynman gauges. ... Standard Model in Feynman gauge . ... This output can be written in LaTeX format and in the form of CompHEP model files, which allows one to start calculations of processes in the new physical model. ...

Еще в разделе: (Показать все результаты (>13) - comphep.sinp.msu.ru/ )

• extra:main [CompHEP]
• news [CompHEP]

Brain Research Group >> Research >> Change-point analysis ... << previous next >> . ... This section presents the results of the application of the methodology described in the previous section to real EEG signal. ... Fig. 7.1. Detection algorithm adapted for the EEG analysis . The EEG (a) was filtered in the alpha band (bandpass 7.5--12.5 Hz) (b) and then the amplitude squared (c); the result is the sequence from which the subintervals are cut out at further steps. ...

Еще в разделе: (Показать все результаты (>37) - brain.bio.msu.ru/ )

Welcome to K -corrections calculator, simple service allowing one to determine K -corrections of a galaxy, given its redshift and one or more colours. ... K -correction in choose filter.. ... Redshift . Colour choose colour.. Colour value . Calculator . ... calculate spectral energy distributions , K-corrections calculator , GALEX FUV NUV , UKIDSS YJHK , K-corrections of galaxies , spectral based k-corrections , SDSS filter set K-corrections , K correction code IDL , kcorrect IDL C , . ...

Еще в разделе: (Показать все результаты (>8) - kcor.sai.msu.ru/ )

• K-corrections calculator (version 2010)

Выберите категорию обращения: Общие вопросы Отчеты Рейтинги Диссертационные советы Конкурсы Ввод данных Структура организаций Пользователи Проблемы с регистрацией\входом в систему . ... Войти в систему . ... Wilson R.L. , Loh Z.M. , Wild D.A. , Bieske E.J. , Buchachenko A.A. в журнале Journal of Chemical Physics , издательство American Institute of Physics (United States) , том 121, ? ...

Еще в разделе: (Показать все результаты (>917) - istina.msu.ru/ )

• Lysenko D.A. - сотрудник | ИСТИНА - Интеллектуальная Система Тематического
• Samdal S. - сотрудник | ИСТИНА - Интеллектуальная Система Тематического
• Mark T.D. - сотрудник | ИСТИНА - Интеллектуальная Система Тематического

... THE PARALLELIZATION OF COMPUTATIONAL ALGORITHMS IN LARGE PHYSICS PROBLEMS ON MULTIPROCESSOR COMPUTER SYSTEM CONTAINING THOUSAND AND MORE OF PROCESSOR ELEMENTS REQUIRES SPECIAL TOOLS. ... THE GENETIC ALGORITHM CAN BE CHARACTERIZED BY THE FOLLOWING PARAMETERS: - coding strategy, - population size, - initialisation strategy, - selection technique, - crossover mechanism, - mutation mechanism, - strategy for offspring inclusion. ... The results are presented on the following figure. ...

Еще в разделе: (Показать все результаты (>49) - acat02.sinp.msu.ru/ )

• http://acat02.sinp.msu.ru/25june.html
• http://acat02.sinp.msu.ru/poster-sessions.html
• http://acat02.sinp.msu.ru/presentations/yudin/trans_total.pdf

Ionization Dynamics of Atoms Exposed to Strong Laser Pulses: Semi­Analytical Model at Low Field Frequencies Yu.V. Popov Skobeltsyn Institute of Nuclear Physics, Lomonosov Moscow State University Collaboration B. Piraux, A. Hamido. ... INTRODUCTION AND MOTIVATIONS Keldysh has introduced the adiabaticity parameter = (2Ip)1/2/E where is the laser field frequency, E, the field amplitude, and Ip the ionization potential of the atom. ... Both of them, multiphoton processes and tunnel ionization play a role. ...

Еще в разделе: (Показать все результаты (>9) - lmmqsp.sinp.msu.ru/ )

• http://lmmqsp.sinp.msu.ru/mat/posterTE_Mongolia.pdf

... The RADEN data bank produced at the Department of Chemistry of Moscow State University is designed as well to accumulate published information on radiative parameters of diatomic molecules, as to analyse it and recommend the more reliable values. ... electronic transition moments D ( R ); . ... dipole moments, . ... FACTUAL RECOMMENDED DATABASE contains now the ab initio and experimental electronic transition moments for more than 250 band systems which belong to more than 100 diatomic molecules. ...

Еще в разделе: (Показать все результаты (>47) - electr003.chem.msu.ru/ )

• Elena V. Stenina: Selected Publications

Welcome , Registration , and other StartingPoints ; TWiki history & Wiki style; All the docs.. ... VarCALC 2 - 2007-06-02 - Main.TWikiContributor . ... The %CALC{"formula"}% variable is handled by the SpreadSheetPlugin . ... Syntax: %CALC{"formula"}% . ... CALC{"$SUM($ABOVE())"}% returns the sum of all cells above the current cell . CALC{"$EXISTS(Web.SomeTopic)"}% returns 1 if the topic exists . CALC{"$UPPER(Collaboration)"}% returns COLLABORATION . ... Copyright by the contributing authors. ...

Еще в разделе: (Показать все результаты (>28952) - dualopt1.cmm.msu.ru/ )

• VarCALC - TWiki - TWiki
• %TOPICTITLE% ( vs. 1) - TWiki
• VarCALC - TWiki - TWiki - (printable)

... Directives | ... Apache HTTP Server Version 2.0 . ... This module controls the setting of the Expires HTTP header and the max-age directive of the Cache-Control HTTP header in server responses. The expiration date can set to be relative to either the time the source file was last modified, or to the time of the client access. ... access . ... If set to On , the headers will be added to served documents according to the criteria defined by the ExpiresByType and ExpiresDefault directives ( q.v. ). ...

Еще в разделе: (Показать все результаты (>75) - itpm.msu.su/ )

. QM/MM approach is applied to modelling of GTP hydrolysis reaction mechanism. We use X-ray structure as initial atom coordinates for QM/MM calculations. We consider 2 systems: free EF-Tu and complex with ribosome.

Еще в разделе: (Показать все результаты (>7) - lcc.chem.msu.ru/ )

... Calculating the Part of the Nonlinearity Parameter for Two Component System . ... The known relation for nonlinearity parameter B/A allows to calculate the pointed quantity if the value of the derivatives of sound velocity u on temperature T and pressure P are known. The dependence of u on T and P for two component mixture can be found from the relation for sound velocity in the mentioned mixture Umix which was derived by the author earlier. ...

Еще в разделе: (Показать все результаты (>122) - acs366.phys.msu.su/ )

... Surface disturbance and deformat ion are shown in the same scale. Displac the free surface is much smoother as compared bottom deformations: init ial elevat ion has amplitude and spreads over a rather wide area. bottom theory, bottom ement of with the smaller F ­ velocity potential, H ­ depth, ­ vector of bottom deformation, 0 ­ initial elevation a . ... The init ial elevation assumed to be equal to the vertical bottom deformat ion (a); calculated with use of the Laplace smoothing algorithm (b). ...

Еще в разделе: (Показать все результаты (>13) - ocean.phys.msu.ru/ )

• http://ocean.phys.msu.ru/science/nosov/EGU2010_pumping.pdf

... Description . Catalog . ... In the Catalog, we publish equatorial (ЮБ 2000 , ЮД 2000 ) and galactic (l,b) coordinates of cluster centers derived as the position of overdensity in 2MASS catalog (Koposov et al. ... Distances, color-excesses and ages are the mean-square values calculated using all available evaluations from different color-magnitude diagrams. ... There are individual pages for every cluster where all available plots and parameters are published. ... 2002). ...

40. http://lav01.sinp.msu.ru/~vlk/report01_wl.ps