Электронная библиотека Попечительского совета . ... Jang M. - LinuxR Patch Management: Keeping LinuxR Systems Up To Date . ... Название: LinuxR Patch Management: Keeping LinuxR Systems Up To Date . ... Whatever your role in managing Linux systems, Linux Patch Management will reduce your costs, enhance the availability of your systems, and dramatically improve your personal efficiency. ... apt, aptitude, patch management . ... Электронная библиотека попечительского совета мехмата МГУ , 2004-2016 . ...

Еще в разделе: (Показать все результаты (>21680) - lib.mexmat.ru/ )

• Iverson W. - Mac OS X for Java Geeks :: Электронная библиотека попечительского
• Roitberg Y. - Elliptic Boundary Value Problems In The Spaces Of Distributions
• Jepson B., Rothman E.E. - Mac OS X Panther for Unix Geeks :: Электронная

... Give an example of chemical reaction between a salt and an acid leading to the formation of another salt and a base. (1 point) [Solution] . ... Write the reactions of chromium (III) bromide with hydrogen peroxide in acidic and basic media. (2 points) [Solution] . ... In the reactions, specify the structures of all substances. (3 points) [Solution] . ... Three substances A, B, and C were mixed in the amount of three moles each. ... Example problems in chemistry for the entrance exams ( main round ) ....

Еще в разделе: (Показать все результаты (>581) - chem.msu.ru/ )

• Entrance Examinations - Main Round

... When done, clean out directory with "make clean". ... NETCDFLIB = $(NETCDF)/ lib NETCDFINC = $(NETCDF)/include SHELL=/bin/sh MAKE _OPTS = RANLIB=$(RANLIB) CFLAGS = -I$(NETCDFINC) $(SI) $(CC_OPT) $(TRIANGLE_D) -fPIC CDF = -L$(NETCDFLIB) -lnetcdf PS = -L. -lpsl GMT = -L. -lgmt LIB _C = fourt.c \ gmt_cdf.c \ gmt_customio.c \ gmt_grdio.c \ gmt_init.c \ gmt_io.c \ gmt_map.c \ gmt_plot.c \ gmt_shore.c \ gmt_stat.c \ gmt_support.c \ gmt_vector.c GMT_H = gmt.h \ gmt_math.h \ ...

Еще в разделе: (Показать все результаты (>824) - xray.sai.msu.ru/ )

• State of the problem
• Initial Distributions of Binary Parameters
• ADS Abstract Service Results

... Temporarily make the "mw-config" directory writable to the user the web server is running as. ... So, please, read the following link and find solution which suits your needs best: http://www.mediawiki.org/wiki/Manual:Installing_MediaWiki#Create_a_database 3. ... After the setup script has finished running successfully, a file called LocalSettings.php is created in the "mw-config" directory. Move this file to the root wiki directory (${MY_INSTALLDIR}): $ mv mw-config/LocalSettings.php . ...

Еще в разделе: (Показать все результаты (>78349) - mirror.msu.net/ )

• http://mirror.msu.net/pub/rfc-editor/rfc-ed-all/rfc954.txt
• http://mirror.msu.net/pub/rfc-editor/rfc-ed-all/pdfrfc/rfc954.txt.pdf
• http://mirror.msu.net/pub/rfc-editor/rfc-ed-all/pdfrfc/rfc775.txt.pdf

DVM-system of parallel program development . Installation guide . ... 1 DVM-system installation under Windows95/NT . ... Microsoft Visual C++ 5.0 version and later (4.0 version can be used with some restrictions, see below); . ... Now the user should copy all files from directory dvm_sys/user to his own directory with DVM programs. ... In this case (but if DVM-system installation was succesfully verified) the user should keep above files with errors and ask for system programmer support. ...

Еще в разделе: (Показать все результаты (>243) - sp.cs.msu.ru/ )

• DVM-system. Installation guide. Version 3.60
• DVM-system. Installation guide. Version 3.82
• DVM-system. Installation guide. Version 3.15

... For those who is interested in thermodynamic modeling . Yuri Shvarov . This page is aimed mainly at the users of the software package HCh for thermodynamic (equilibrium) modeling of (geo)chemical systems and processes. However, some files presented here may also be of some interest to those who do not use HCh. ... HCh for DOS . ... User's guide for the Unitherm program intended for maintaining thermodynamic databases and calculation of thermodynamic properties of substances . ...

Еще в разделе: (Показать все результаты (>100) - www.geol.msu.ru/ )

• Software for resistivity and induced polarization

... Run engine.exe. ... Choose "Basic Channels" property sheet. Setup basic channels. ... The two channels with changing indicator are microphone inputs (left channel for close microphone and right one for far one), and the rest one are additional channels (left for photo sensor and right for breath sensor). ... Do not forget to reset and setup spectral channels after each new start of Engine program and after adding or modifiing of spectral channels (i.e. every time when you press Options button). ...

Еще в разделе: (Показать все результаты (>147) - www.intsys.msu.ru/ )

• Intelligent Systems :: Research :: :: Articles
• Интеллектуальные системы :: Сотрудники :: Гасанов Эльяр Эльдарович :: Instantly
• Intelligent Systems :: Research :: :: Demos

Symbolic circuit-matrix processor and evaluator . ... This software is reliable over the range of benchmark circuit complexity (both *.CIR and *.MAT file). ... SYMBOL is a symbolic-algebra package which in contrast to REDUCE, MACSYMA, MAPLE, MATHEMATICA, MathLAB, MathCAD and other known multi-purpose systems is especially intended for analysis of any lumped, linear, time-invariant circuit. ... pure ASCII text . ... CIRSYM - SYMbolic CIRcuit processor used to format ASCII text file *.out for CALCSYM. ...

Еще в разделе: (Показать все результаты (>16) - astrometric.sai.msu.ru/ )

. Moscow State University . INTERNATIONAL CONFERENCE . H YDRODYNAMIC I NSTABILITY AND T URBULENCE . February 24 ? March 02 , 2008 . Moscow, Russia . Call For Papers Информационное письмо . Author instructions . Abstract example Paper example . Location (More information) . Conference Program Posters . E-mail : gertsens@imec.msu.ru . Institute of Mechanics, Lomonosov Moscow State University . Aerodynamical Installations . Moscow Sights & Attractions

Еще в разделе: (Показать все результаты (>33) - hit-conf.imec.msu.ru/ )

... The source control in the problem of heat conduction" . Morozov V.A., Lezhnev V.G., Tokarev N.M. 0) temperature distribution is considered. The correctness of the problem is proved, a convergent algorithm is constructed, and an algorithm for solving the inverse problem of heat conduction is proposed. ... Keywords: heat conduction, boundary value problems, inverse problem of heat conduction, control of distributed parameters . PDF (in Russian) (121KB) . PDF. zip (in Russian) (98.7KB) . ...

Еще в разделе: (Показать все результаты (>649) - num-meth.srcc.msu.ru/ )

• "Inverse problems of formation for the molecular-weight distribution in
• "Solving of optimization hydrodynamic problems using the distributed computing
• "Dynamically generated parallel environments in grid-polygons: problems and

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>24) - mouse.genebee.msu.ru/ )

• Nhunt: program for nucleic acid sequence similarity search
• Align tool for DNA-protein complexes

You are here: Foswiki > System Web > ReferenceManual > DeveloperDocumentationCategory > PerlDoc (19 Apr 2011, ProjectContributor ) E dit A ttach . ... ObjectMethod pkgname([$name]) . ... ObjectMethod Manifest () . ... File View - lists the attributes of each file in the package . Attachment View - list the files to be attached to each topic. ... MANIFEST . path/file.name} Distributed filename root is Foswiki root. {ci} - Flag specifying if file should be checked into the RCS system . ...

Еще в разделе: (Показать все результаты (>23263) - wiki.cs.msu.ru/ )

• YahooUserInterfaceContrib < System < Foswiki
• InstallationGuide < System < Foswiki

... Download NPG-explorer . ... Build nucleotide pangenome . ... Here we provide a table for 3 Brucella genomes: all: embl :CP002459 BRUMM chr1 c Brucella melitensis M28 chromosome 1 all: embl :CP002460 BRUMM chr2 c Brucella melitensis M28 chromosome 2 all: embl :CP003176 BRUAO chr1 c Brucella abortus A13334 chromosome 1 all: embl :CP003177 BRUAO chr2 c Brucella abortus A13334 chromosome 2 all: embl :CP002078 BRUPB chr1 c Brucella pinnipedialis B2/94 chromosome 1 all: ... Fix bugs....

Еще в разделе: (Показать все результаты (>7258) - mouse.belozersky.msu.ru/ )

• wLake program homepage

Next] [Previous] [Top] [Contents] [Index] [netCDF Home Page] [Unidata Home Page] . ... The Unidata Program Center has developed a units library to convert between formatted and binary forms of units specifications and perform unit algebra on the binary form. Though the units library is self-contained and there is no dependency between it and the netCDF library, it is nevertheless useful in writing generic netCDF programs and we suggest you obtain it. ... Celsius . ... nit (unit of photometry) . ...

Еще в разделе: (Показать все результаты (>239) - angel.cs.msu.su/ )

• ExtensionFileFilter

... Fast Facts about the Faculty of Journalism . ... Academic Departments . ... Partners . ... All partners . ... During the round table, NAMMI and Lomonosov Moscow State University were represented by Sergey Smirnov, associate professor of the Faculty of Journalism of Lomonosov Moscow State University. ... 1999-2014 Faculty of Journalism, Lomonosov Moscow State University . ...

Еще в разделе: (Показать все результаты (>169) - www.journ.msu.ru/ )

... Science and education . ... Scientific Laboratories . ... 3-d International Laser Graduate School "Modern Problems of Laser Physics LGS-2009 " . ... Main Science and education Scientific Laboratories Laboratory of theoretical problems in optics . ... Andreev Anatoliy Vasil'evich professor, Doctor of science . Konovko Andrey Andreevich Associate professor, Ph.D. Ponomarev Yuriy Vladimirovich Associate professor, Ph.D. Shutova Ol'ga Anatol'evna assistant professor, Ph.D. Ph.D. students . ...

Еще в разделе: (Показать все результаты (>750) - ofvp.phys.msu.ru/ )

• Publication
• Laboratory of nonlinear polarization optics

Apache2 Ubuntu Default Page . It works! This is the default welcome page used to test the correct operation of the Apache2 server after installation on Ubuntu systems. ... Ubuntu's Apache2 default configuration is different from the upstream default configuration, and split into several files optimized for interaction with Ubuntu tools. ... The configuration layout for an Apache2 web server installation on Ubuntu systems is as follows: /etc/apache2/ |-- apache2.conf | ... Document Roots . ...

38. http://geo.web.ru/conf/alkaline/2009/Shildt.htm

39. GML MatLab Camera Calibration Toolbox | Graphics and Media Lab

40. Fulbright Program in Russia: Prospects and Problems of the Community of...