The Database of Close Binary Systems . ... Team . ... This web-based interactive database is being developed and maintained by a team at the Sternberg Astronomical Institute of the Moscow State University . The project is an on-line extension of our catalogue on "Highly Evolved Close Binary Stars" (volumes I, II) published by Gordon and Breach in 1996. As of September 2009, the database (both the software and the content) is in its development/testing phase. ...

Еще в разделе: (Показать все результаты (>3) - dionis.sai.msu.ru/ )

... Геология >> Геохимические науки >> Кристаллография | ... On-line минералогическая база данных, содержащая около 4500 записей. ... Р-Т тренды и модель формирования гранулитовых комплексов докембрия: . ... Моделирование фазовых равновесий при кристаллизации базальтовых магм: GLAVA2 6 . Моделирование фазовых равновесий при кристаллизации базальтовых магм: Литература англ . ...

Еще в разделе: (Показать все результаты (>134) - geo.web.ru/ )

• Geochemical Rock Database - Все о Геологии (geo.web.ru)
• Database of Raman spectroscopy, X-ray diffraction and chemistry of minerals -

. Laboratory for Neurophysiology and Neuro-Computer Interfaces . M.V.Lomonosov Moscow State University . Faculty of Biology . EEG Records Databases . EEG Databases available: . EEG of healthy adolescents and adolescents with symptoms of schizophrenia . Event-related potentials in a moving matrix modification of the P300 BCI . Other databases will be available soon.

Еще в разделе: (Показать все результаты (>5) - brain.bio.msu.ru/ )

• EEG Database - Schizophrenia

... 06-Mar-2012 17:50 . ... 17-Oct-2011 14:23 . 1.8K . ... 284 . ... 03-Dec-2010 15:29 . 25K . ...

Еще в разделе: (Показать все результаты (>2230) - swx.sinp.msu.ru/ )

• Index of /models/database/db/010128
• Index of /models/database/db/010402
• Index of /models/database/db/001124

... Data . ... Solar flare database (RU) . ... CH area is measured in relative units, where total area of the Sun equals one unit. Minimal significant area is 0.002 relative units. Average intensity is calculated after filtering and histogram scaling into the range from 0 to 255. ... Coronal holes count . Total area of coronal holes . Average intensity over coronal holes . Average intensity over image . ...

Еще в разделе: (Показать все результаты (>67) - smdc.sinp.msu.ru/ )

• Space monitoring data center
• Scientific services - Space monitoring data center
• Home - Space monitoring data center

... Hartree - Fock wave functions of atoms and ions . 1.1 Ground state (Z 18) (206 Tables) . 1.2 Ground state (Z 19) (216 Tables) . ... Configuration interaction wave functions of He-like ions . ... 2.3 (1snd) 1; D and (2p2p) 1; D (143 Tables) . ... 2.6 (1snd) 3; D (105 Tables) . ... 4.1 Hartree - Fock wave functions (290 Kb) . 4.2 Hartree - Fock wave functions of excited states (1.4 Mb) . 4.3 Configuration interaction wave functions of He-like ions (281 Kb) . ...

Еще в разделе: (Показать все результаты (>4906) - cdfe.sinp.msu.ru/ )

• CDFE provides the major photonuclear databases. Online Services.
• CDFE => Online Services => Relational ENSDF
• CDFE - Centre for Photonuclear Experiments Data - Home page

. Compiled from literature sources . version 1.0 . Scientific name . Family . English common name . Native common names . General use . Specific uses . Reference

Еще в разделе: (Показать все результаты (>80) - herba.msu.ru/ )

• Moscow State University, Geobotany dpt. - View Staff

. Parent Directory . 00-index . bullet25.zip . cslio205.zip . db02.zip . dbf2msql-2.0.zip . dbf2mysql-1.10d.zip . dbf_edit1_0.zip . dbffg04b.zip . dbfin096.zip . dbi-1_02.zip . dbv05.zip . mbase205.zip . msql-bench.zip . msql-mysql-modules-1_2010.zip . msql207b1.zip . mysql-c.zip . mysql-client-3.22.26a.zip . mysql2-3.22.26a.zip . odb.zip . os2mb106.zip . postgres652.zip . postgres7.0.0-server-bin_os2.zip . viper092.zip . www-mysql-0.5.7.zip . xdbfj19a.zip

Еще в разделе: (Показать все результаты (>118) - crydee.sai.msu.ru/ )

• Work notes

. The "Areola" system database . Bryzgalov P.A. The paper describes the database of the "Areola" system - a program shell for creating online encyclopedia. In particular, the database structure, the processes of initial data input, detecting errors and editing information in the database are described. PostScript (in Russian) (104KB) . PDF (in Russian) (108KB) . PostScript. zip (in Russian) (30.4KB) . PDF. zip (in Russian) (43KB) . Bryzgalov P.A. e-mail: pyotr777@guru.ru

Еще в разделе: (Показать все результаты (>23) - num-meth.srcc.msu.ru/ )

• "A hybrid database (information system) on the molecular spectral constants"
• "Updatable XML-views over relational databases"
• "Data structuring and formalization in the hybrid database on molecular

Databases (NSDC) of the Natural Planetary Satellites. ... NSDC: Database of astrometric observations of Natural Planetary Satellites . ... They are thoroughly looking for observations in different sources, creating their owndatabases which are then mostly inaccessible to other researchers. ... In the file "content" with explications, the reference is given to the data source as well as the bibliographic reference. ... Data sources. ... Why a specific bibliographic database for Natural satellites? ...

Еще в разделе: (Показать все результаты (>37) - lnfm1.sai.msu.ru/ )

• Division of the Galaxy and Variable Stars
• Natural Satellites Data Center. Objectiv.

... This document provides a set of guidelines for the administration and operation of public Network Information Center (NIC) databases. The purpose is to formalize procedures for the responsible handling of the personal and organizational information maintained by NICs in publically accessible databases, and to improve the accuracy and accessibility of such data where appropriate. ... The first part contains recommendations for preventing unauthorized disclosure of information in NIC databases. ...

Еще в разделе: (Показать все результаты (>6014) - mirror.msu.net/ )

• Index of /pub/gentoo-portage/dev-ruby/database_cleaner/
• Index of /pub/gentoo-portage/dev-python/dj-database-url/
• Index of /pub/gentoo-portage/dev-util/monodevelop-database/

Home . Database of structures of nucleic acid - protein complexes . ... List of complexes . Pfam families . SCOP families . Interaction classes . ... NPIDB . ... Information on SCOP and Pfam domains detected in protein chains is presented. ... Each family has its own web page with the list of entries that include domains of the family. ... List of SCOP domains occurred in DNA-protein and RNA-protein complexes is organized in tree-like form, according to the SCOP classification. ...

Еще в разделе: (Показать все результаты (>2) - npidb.belozersky.msu.ru/ )

• NPIDB: About Us

... Sbjct : 9135 ctggc 9131 Database : thr Posted date: Feb 20, 2008 8:14 PM Number of letters in database : 12,243,887 Number of sequences in database : 884 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Sequences : 884 Number of Hits to DB: 142,083 Number of extensions: 8872 Number of successful extensions: 67 Number of ...

Еще в разделе: (Показать все результаты (>1293) - kodomo.fbb.msu.ru/ )

• http://kodomo.fbb.msu.ru/~element/Term3/pm.txt
• http://kodomo.fbb.msu.ru/~smivic/Projects/Term_3/Downloads/gluq_pm.blast
• http://kodomo.fbb.msu.ru/~element/Term3/gomolog.txt

... A UNIX system has a lot of daemons. a database is the name given to the combination of a program that can manipulate data, together with the data that it acts upon. a record is a set of data about a person or item. Name, telephone number and postcode is an example of such a set. a field is one part of that record; the postcode for example. a delimiter character separates each field from the field preceding it and the field that follows it. ...

Еще в разделе: (Показать все результаты (>26) - comet.sai.msu.ru/ )

• Digitized Sky Engines
• Miscellaneous
• Index of manual pages: A

Infrastructure for statistical education . Since 2003 the UIS RUSSIA team concentrates at statistical domain aiming to implement an infrastructure for statistical education and evidence-based applied analysis and full scale social and economic investigations. The RF State Statistical Agency publications are processed and arranged into databases «Regions of Russia», «Cities» and «Municipalities». The databases update indicators on 83 RF regions, 1071 cities and 25000+ municipal units. ...

Еще в разделе: (Показать все результаты (>19) - srcc.msu.ru/ )

• Научно-исследовательский вычислительный центр МГУ
• Структура НИВЦ

php /* * Backup script on server. ... Connects to the mySQL * database and creates a backup file of the whole database. ... Yes/No? ... It will void your warranty :-D! $ date = date ( mdy-hia ); $filename = $savepath/$dbname-$ date .sql ; if($use_gzip== yes ){ $ filename2 = $ file ; } else { $ filename2 = $savepath/$dbname-$ date .sql ; } if($send_email == yes ){ $fileatt_type = filetype($ filename2 ); $ fileatt_name = .$dbname. - .$ ... BR>"; $message .= "--{$mime_boundary}\n" ." ...

Еще в разделе: (Показать все результаты (>7) - observ.pereplet.ru/ )

• http://observ.pereplet.ru/images/evgeny/xorg.conf

The development of the method for the analysis of proteomics data Dmitry S. Ischenko, V. Popkov Moscow Institute of Physics and Technology, Dolgoprudny, Russia, ischenko.dmitry@gmail.com Dmitry G. Alexeev Scientific-Research Institute of Physicochemical medicine, Moscow, Russia, exappeal@gmail.com In the analysis of mass spectrometry data of unannotated sample the problem is in an adequate evaluation of the results. The question is: what to choose as a protein database for searching? ...

Еще в разделе: (Показать все результаты (>106) - mccmb.belozersky.msu.ru/ )

• http://mccmb.belozersky.msu.ru/2013/abstracts/abstracts/222.pdf
• http://mccmb.belozersky.msu.ru/2013/abstracts/abstracts/202.pdf
• http://mccmb.belozersky.msu.ru/2013/abstracts/abstracts/39.pdf

... Show databases показывает только br | information_schema | br | mysql љљљљљљљљљљљљљ | br | testљљљљљљљљљљљљљљ | br br љЧестно говоря, сразу после установки ошибка была другая: br ..... br Tue Jan 18 23:21:04 GMT 2011 : apel-publisher - ------ Starting the apel application ------ br Tue Jan 18 23:21:05 GMT 2011 : apel-publisher - program aborted br org.glite ... opt/glite/bin/apel-publisher -f<br> . ... gt; Wed Jan 19 23:21:08 GMT 2011: apel-publisher - ------ Starting the apel<br> . ...

Еще в разделе: (Показать все результаты (>138) - theory.sinp.msu.ru/ )

• [RU-NGI] glite-APEL installation
• Mikhail N. Smolyakov
• [RU-NGI] apel EMI3

... MG1655 chromosome, complete genome Length=300 Score E Sequences producing significant alignments: (Bits) Value embl|AE009441|AE009441 Pyrobaculum aerophilum str. ... Length=2222430 Score = 98.4 bits (402), Expect = 5e-21 Identities = 150/234 (65%), Gaps = 1/234 (0%) Strand=Plus/Plus Query 68 CCCGCAGAAGAAGCACCGGCTAACTCCG-TGCCAGCAGCCGCGGTAATACGGAGGGTGCA 126 || ... Sbjct 97796 GTTCTCCCGCCGAAGTGCTTGAGATACTCGCAACCGTGAATCTCAAAAAGAGG 97848 > embl|AE006641|AE006641 Sulfolobus solfataricus P2, complete...

Еще в разделе: (Показать все результаты (>16) - mouse.genebee.msu.ru/ )

• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/blast_default.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/megablast.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex3/megablast.out

... To edit pages on this TWikiSite , you must have a registered user name and password. ... This database is accessible to anyone who can access the server through the web (though passwords will be encrypted, and e-mail addresses will be obfusticated to help prevent spamming). ... When TWiki receives the form, it will mail an account activation code to the e-mail address you gave above. ... Create your personal TWiki topic using your WikiName as topic name, and add the data you submitted to the topic. ...

Еще в разделе: (Показать все результаты (>20552) - dualopt1.cmm.msu.ru/ )

• TWikiRegistration - TWiki - TWiki - (printable)
• CGISessionDriverDBIDotPm - TWiki - TWiki
• %TOPICTITLE% ( vs. 1) - TWiki