... Length=2222430 Score = 55.4 bits (60), Expect = 6e-08 Identities = 53/68 (78%), Gaps = 0/68 (0%) Strand=Plus/Plus Query 141 TTACTGGGCGTAAAGCGCACGCAGGCGGTTTGTTAAGTCAGATGTGAAATCCCCGGGCTC 200 || Sbjct 1090874 TTACTGGGCTTAAAGCGCCCGTAGCCGGCCCGGCAAGTCGCTCCTGAAATCCCCGGGCTC 1090933 Query 201 AACCTGGG 208 || ... Sbjct 2071246 AGCCGCGGTAATACGG 2071261 Score = 28.3 bits (30), Expect = 8.9 Identities = 15/15 (100%), Gaps = 0/15 (0%) Strand=Plus/Plus Query 222 ACTGGCAAGCTTGAG 236 || ...

Еще в разделе: (Показать все результаты (>27) - mouse.genebee.msu.ru/ )

• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/blast.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/megablast.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex3/nhunt-2.out

You are here: Iono Group / SAMNET / Magnetometers database . More information about each magnetometer is available by clicking on the station link. ... IMAGE . Alta, Norway . ... Andenes, Norway . ... SAMNET . ... BGS station, but archived at 1s resolution by SAMNET . ... Hankasalmi, Finland . ... IMAGE station, but archived at 1s resolution by SAMNET . ... 1s resolution data is available from the SAMNET data archive . ... This list can be filtered to show just SAMNET magnetometers . ...

Еще в разделе: (Показать все результаты (>22) - www.kosmofizika.ru/ )

• Index of /spravka/Magnetometers Database.files

Next: Reverse Lookups Up: The Domain Name System Previous: Domain Name Servers . We have seen above that DNS does not only deal with IP-addresses of hosts, but also exchanges information on name servers. ... A single piece of information from the DNS database is called a resource record , or RR for short. ... Figure- shows a part of the domain database that is loaded into the name servers for the physics.groucho.edu zone. ... This comprises, for instance, the default time-to-live for all records. ...

Еще в разделе: (Показать все результаты (>162) - itpm.msu.su/ )

• The paths database
• MySQL Reference Manual for version 3.23.10-alpha. - A Some MySQL users
• mod_auth_dbm - Apache HTTP Server

... Ariskin A.A., Bouadze K.V., Meshalkin S.S., Tsekhonya T.I. (1992) INFOREX: A database on experimental studies of phase relations in silicate systems. ... Meshalkin S.S., Ariskin A.A., Barmina G.S., Nikolaev G.S., Almeev R.R. (1996) Development of a database on experimental crystal-melt equilibria for igneous rocks: INFOREX system, version-3.0. ... Meshalkin S.S., Ariskin A.A. (1996) INFOREX-3.0: A database on experimental phase equilibria in igneous rocks and synthetic systems. ...

Еще в разделе: (Показать все результаты (>168) - geo.web.ru/ )

• Geochemical Rock Database - Все о Геологии (geo.web.ru)
• Mineralogy Database - Все о Геологии (geo.web.ru)
• Database of Raman spectroscopy, X-ray diffraction and chemistry of minerals -

Базы данных и таблицы . Проект ?Динамика экономического и социального развития России в XIX ? ... проект поддержан РГНФ, ?10-01-12114в) . Электронный ресурс - база данных 'Социально-экономические и политические факторы стачечного движения в России (1895-1904 гг.) Проект РФФИ ? ... Электронный ресурс - база данных "Агитационные материалы общественных движений, организаций и политических партий на начальном этапе массового рабочего протеста в России (1895-1904 гг.) Проект РГНФ ? ...

Еще в разделе: (Показать все результаты (>99) - hist.msu.ru/ )

The Chair of Mathematical Theory of Intelligent Systems and . Laboratory of Problems of Theoretical Cybernetics . ... MaTIS Chair . ... Research . ... Computer Solver . ... development of computer teaching systems . Information Monitoring . creating the systems of information monitoring . Search in Databases . systems of fast search in extensive databases . ... The Chair of Mathematical Theory of Intelligent Systems, Laboratory of Problems of Theoretical Cybernetics . ...

Еще в разделе: (Показать все результаты (>61) - www.intsys.msu.ru/ )

• Intelligent Systems :: Research

Home . ... Activities . ... Laboratory of Mathematical Methods of Image Processing . Chair of Mathematical Physics . ... Image enhancement . ... Rank image filtering . Image analysis . ... Ringing effect . ... Database . ... Medical imaging . ... Multiresolution analysis and processing . ... The final version of the developed ringing database is available here: . ... The ringing extension of TID 2013 database: . ...

Еще в разделе: (Показать все результаты (>67) - imaging.cmc.msu.ru/ )

The Database of Close Binary Systems . ... Team . ... This web-based interactive database is being developed and maintained by a team at the Sternberg Astronomical Institute of the Moscow State University . The project is an on-line extension of our catalogue on "Highly Evolved Close Binary Stars" (volumes I, II) published by Gordon and Breach in 1996. As of November 2009, the database (both the software and the content) is in its development/testing phase. Sternberg Astronomical Institute ...

Еще в разделе: (Показать все результаты (>4) - uranus.sai.msu.ru/ )

• Stellar Astrophysics Department

News . ... Archive of News . Third international conference “Advances in the biology of shrews III” Third circular . ... Ecology . ... Rozhnov V.V., Prof., Deputy Director of A.N. Severtsov Institute of Ecology and Evolution. ... Kalinin A.A., Dr., A.N. Severtsov Institute of Ecology and Evolution (Moscow, Russia) . ... Kouptsov A.V., Dr., A.N. Severtsov Institute of Ecology and Evolution (Moscow, Russia) . ... Pavlova S.V., Dr., A.N. Severtsov Institute of Ecology and Evolution (Moscow, Russia) . ...

Еще в разделе: (Показать все результаты (>1125) - www.sevin.ru/ )

• Laboratories: Molecular Diagnostics Methods Room: Goals and Tasks
• A.N. Severtsov Institute of Ecology and Evolution (IPEE RAS): News: News:

... About lab . ... Online Journal "Computer graphics and multimedia" (in russian) . ... Image Database Retrieval by Fast Hermite Projection Method . ... http://graphics.cs.msu.ru/en/publications/text/gc2005kk.pdf . ...

Еще в разделе: (Показать все результаты (>93) - graphics.cs.msu.ru/ )

• Image Database Retrieval by Fast Hermite Projection Method | Лаборатория
• Semiautomatic Visual-Attention Modeling | Graphics and Media Lab
• Semiautomatic Visual-Attention Modeling | Лаборатория компьютерной графики и

... Data . ... Solar energetic particles . ... Nucleon . ... Particle spectra at LEO . ... Overview ] [ Documentation ] [ SEP Events ] [ SEP Model ] . ... 1.2 High-energy heavy ions (Z = 6, 7, 8, 10, 12, 14, 16, and 26) by ACE spacecraft (SIS instrument) data are selected from: . ... The SEP events were selected by GOES-8 4th channel (15-40 MeV) data (see Fig.1). ... E тАУ ionтАЩs kinetic energy in MeV/nucl; Moc2 =938 MeV тАУ nucleon rest energy; †Я=v/c тАУ particleтАЩs relative velocity. ...

Еще в разделе: (Показать все результаты (>68) - smdc.sinp.msu.ru/ )

• Coronal holes database - Space monitoring data center
• Scientific services - Space monitoring data center
• Home - Space monitoring data center

The Database of Close Binary Systems . ... Team . ... This web-based interactive database is being developed and maintained by a team at the Sternberg Astronomical Institute of the Moscow State University . The project is an on-line extension of our catalogue on "Highly Evolved Close Binary Stars" (volumes I, II) published by Gordon and Breach in 1996. As of September 2009, the database (both the software and the content) is in its development/testing phase. ...

Еще в разделе: (Показать все результаты (>3) - dionis.sai.msu.ru/ )

. Laboratory for Neurophysiology and Neuro-Computer Interfaces . M.V.Lomonosov Moscow State University . Faculty of Biology . EEG Records Databases . EEG Databases available: . EEG of healthy adolescents and adolescents with symptoms of schizophrenia . Event-related potentials in a moving matrix modification of the P300 BCI . Other databases will be available soon.

Еще в разделе: (Показать все результаты (>26) - brain.bio.msu.ru/ )

• EEG Database - Schizophrenia

... 06-Mar-2012 17:50 . ... 17-Oct-2011 14:23 . 1.8K . ... 284 . ... 03-Dec-2010 15:29 . 25K . ...

Еще в разделе: (Показать все результаты (>2235) - swx.sinp.msu.ru/ )

• Index of /models/database/db/010128
• Index of /models/database/db/010402
• Index of /models/database/db/001124

... Пользователи -General- Common Current University Society Study Diaspora FAQ Real Estate -Technical- Development Hard&Soft Network Mobile -Market- Market Services Job -Hobby- Behemoth Health Love&Sex Еда Media Games Auto&Moto Sport Hobby Flood Zone -Servant- Alternative Forums Forum -Garbage- Revolution Garbage Private . ... Chemists, Attention! Search on databases! ... Search on databases! [ re: olenka_chem ] . ... Search on databases! [ re: egoist ] . ... Из: IT UK CH . ...

Еще в разделе: (Показать все результаты (>989) - www.fds-net.ru/ )

• Java Swing, Database - Public forum of MSU united student networks
• Embedded firebird database - вопрос по скорости - Public forum of MSU united

... Moscow University Search Engine . AstroSearch - search astronomical sites . Open FTS search engine . MailWare (PostgreSQL mailing list archive) Our commercial interests . ... This full text search engine by XWare team provides the document search over all Moscow State University Web sites. ... OpenFTS (Open source Full Text Search) is an advanced PostgreSQL-based search engine that provides online indexing of data and relevance ranking for database searching. ... 2001-116 XWare Team. ...

Еще в разделе: (Показать все результаты (>3686) - www.astronet.ru/ )

• Astronet > Sky Map, professional edition
• Journal "Peremennye Zvezdy"

... Современная видовая принадлежность: Conus glans . Первоначальное написание названия: Conus fusiformis Fischer von Waldheim, 1807, . ... junior synonym of Conus glans Hwass, 1792 . ... Первоописание: Fischer G. 1807. ... Vol. ... Type specimens and identity of the describes species of Conus. ... The species described 1801-1810. ...

Еще в разделе: (Показать все результаты (>4514) - zmmu.msu.ru/ )

... FTP : HEASARC LEGACY data . ARIEL-5 All-Sky Monitor (ASM) Lightcurves Database . X-ray and optical light-curves of XNs at HEASARC LEGACY . Collected X-ray and optical light-curves of A 0620-00 and GS 1124-683 . ... About FITS format FITS resources from HEASARC . Related Astrophysics Sites . ... Cambridge University Press Handbook of Space Astronomy and Astrophysics . Neutron Stars and Black Holes in X-Ray Binaries Jan van Paradijs . ... Catalogue of Low-Mass X-Ray Binaries . ...

Еще в разделе: (Показать все результаты (>183) - xray.sai.msu.ru/ )

• Be/X-ray binaries and candidates

As it was already mentioned, the idea behind File Juggler is rather simple: using CGI scripts as processing tools and WWW browser as user interface, display the structure and content of typical anonymous FTP server in a convenient, easily navigated form. ... My P5-133 spends about 0.025 ms on one file when doing linear search with simple criterion (690 ms for 27,000 files, search for substring among file names/descriptions with 70 hits). ... Let's now look whether we can handle 1,000,000 files. ...

Еще в разделе: (Показать все результаты (>729) - crydee.sai.msu.ru/ )

• Index of /ftproot/pub/comp/os/os2/leo/database

Home . Database of structures of nucleic acid - protein complexes . ... List of complexes . Pfam families . SCOP families . Interaction classes . ... NPIDB . ... Information on SCOP and Pfam domains detected in protein chains is presented. ... Each family has its own web page with the list of entries that include domains of the family. ... List of SCOP domains occurred in DNA-protein and RNA-protein complexes is organized in tree-like form, according to the SCOP classification. ...

Еще в разделе: (Показать все результаты (>7) - npidb.belozersky.msu.ru/ )

• NPIDB: About Us